View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16549_high_45 (Length: 255)

Name: NF16549_high_45
Description: NF16549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16549_high_45
NF16549_high_45
[»] chr6 (1 HSPs)
chr6 (18-247)||(10024504-10024733)


Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 10024504 - 10024733
Alignment:
Q  18 aattttacgttttctctggttttcgtgattgtcagtaaccggcgcgagagctgatgagggggtaattttttaactgaatttttcgtttattgaacaaaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  10024504 aattttacgttttctctggttttcgtgattgtcagtaaccggcgcgagagctgatgaggaggtaattttttaactgaatttttcgtttattgaacaaaat 10024603  T
Q  118 gttgctttagaagtttttcttctaatcatttaacaatgtacagacaattgacagattaattgagaccggtgacagcgaacaaattttccagaaggctatt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10024604 gttgctttagaagtttttcttctaatcatttaacaatgtacagacaattgacagattaattgagaccggtgacagcgaacaaattttccagaaggctatt 10024703  T
Q  218 caggaacaaggacgaggccaggttcatctc 247  Q
    ||||||||||||||||||||||||||||||    
T  10024704 caggaacaaggacgaggccaggttcatctc 10024733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University