View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16546_low_24 (Length: 293)

Name: NF16546_low_24
Description: NF16546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16546_low_24
NF16546_low_24
[»] chr5 (2 HSPs)
chr5 (12-84)||(27357761-27357833)
chr5 (237-276)||(26544137-26544176)


Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 84
Target Start/End: Original strand, 27357761 - 27357833
Alignment:
Q  12 agagataccaaagaggtggttgatgaaatcaagataatgtcttggaaataaggtttgagtagtactgattttt 84  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27357761 agagataccaaagaggtggttgatgaaatcaagataatgtcttggaaataaggtttgagtagtactgattttt 27357833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 237 - 276
Target Start/End: Original strand, 26544137 - 26544176
Alignment:
Q  237 gtttaggcatacgattaatgagtgacaaatttacgtgaat 276  Q
    ||||| ||||||||||||||||||||||||||| ||||||    
T  26544137 gtttatgcatacgattaatgagtgacaaatttatgtgaat 26544176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University