View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16545_low_15 (Length: 216)

Name: NF16545_low_15
Description: NF16545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16545_low_15
NF16545_low_15
[»] chr5 (1 HSPs)
chr5 (16-177)||(40181918-40182079)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 177
Target Start/End: Complemental strand, 40182079 - 40181918
Alignment:
Q  16 cataggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtttgtctccaaccgattctcactcgcaaactatatat 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  40182079 cataggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtctgtctccaaccgattctcactcgcaaactatatat 40181980  T
Q  116 aagaagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcacttcttcttcttc 177  Q
    | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40181979 atgcagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcacttcttcttcttc 40181918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University