View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16545_low_14 (Length: 236)

Name: NF16545_low_14
Description: NF16545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16545_low_14
NF16545_low_14
[»] chr5 (1 HSPs)
chr5 (16-220)||(37245696-37245900)
[»] chr8 (3 HSPs)
chr8 (98-220)||(4261067-4261189)
chr8 (78-216)||(1194441-1194578)
chr8 (131-216)||(27664401-27664486)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 37245696 - 37245900
Alignment:
Q  16 tacttctacgggtgccaacaacggcactactttgacagacccttcacagagtactacctcatagtaatatgtttattctagtgatggacctaattctgtt 115  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  37245696 tacttctacgagtgccaacaacagcactactttgacagacccttcacagagtactacctcatagtactatgtttattctagtgatggacctaattctgtt 37245795  T
Q  116 acggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagtttaagttcgttgatggaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37245796 acggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagtttaagttcgttgatggaa 37245895  T
Q  216 gcatt 220  Q
    |||||    
T  37245896 gcatt 37245900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 98 - 220
Target Start/End: Original strand, 4261067 - 4261189
Alignment:
Q  98 gatggacctaattctgttacggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagt 197  Q
    ||||||||||||| |||| |||||||||  || ||||||||||  |||   ||||||||||||| ||| || |||  |||||||||| ||||||||||||    
T  4261067 gatggacctaattatgtttcggttacactgcttttggatggaaaaaactttcttgcttgggctcgagcgattcgtcatgctttaggtgctaagaacaagt 4261166  T
Q  198 ttaagttcgttgatggaagcatt 220  Q
    || ||||||||||||||||||||    
T  4261167 ttcagttcgttgatggaagcatt 4261189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 78 - 216
Target Start/End: Original strand, 1194441 - 1194578
Alignment:
Q  78 agtaatatgtttattctagtgatggacctaattctgttacggttacacctctcttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgc 177  Q
    |||| |||||| || |||||||||||||||||| ||||| |||||||||  | || |||  ||||||| | ||| ||||||||  ||| || ||| ||||    
T  1194441 agtactatgttcatcctagtgatggacctaattttgtta-ggttacaccaattttagataaaagcaactatctttcttgggcttgagccattcgtcgtgc 1194539  T
Q  178 tttaggttctaagaacaagtttaagttcgttgatggaag 216  Q
    ||||||  |||||||||||||| | || |||||||||||    
T  1194540 tttaggggctaagaacaagtttcaatttgttgatggaag 1194578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 216
Target Start/End: Original strand, 27664401 - 27664486
Alignment:
Q  131 ttggatggaagcaacaaccttgcttgggctcaagcaatgcgttgtgctttaggttctaagaacaagtttaagttcgttgatggaag 216  Q
    ||||||||||||||| | |||||||||| |||| | ||| || |||| ||| || ||||||||| |||| ||||||||||| ||||    
T  27664401 ttggatggaagcaactatcttgcttgggatcaaacgatgtgtcgtgcattaagtgctaagaacatgtttcagttcgttgatcgaag 27664486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University