View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16543_high_20 (Length: 349)

Name: NF16543_high_20
Description: NF16543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16543_high_20
NF16543_high_20
[»] chr2 (1 HSPs)
chr2 (4-213)||(6942697-6942910)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 4 - 213
Target Start/End: Original strand, 6942697 - 6942910
Alignment:
Q  4 cgtgagatatttgcattgaggatcgttattggtgttggac----acatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgc 99  Q
    ||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6942697 cgtgagatatttgcattgaggatcgttattggtgttggacttggacatcacaaattgtgtttgaacaaaatgttgttttagttatcaccaagtttgatgc 6942796  T
Q  100 atgcattgtacttccagaaaaatggatgagataatttatcaaactgagtattgcttcaaagattggttgcatcaagaatctatcaaaatggttgagagaa 199  Q
    ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||    
T  6942797 atgcattatacttccagaaaaatggatgagataatttatcgaactgagtattgcttcaaagattggttgcatccagaatctatcaaaatgattgagagaa 6942896  T
Q  200 tttatcagatgctc 213  Q
    ||||||||||||||    
T  6942897 tttatcagatgctc 6942910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University