View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16537_low_17 (Length: 230)

Name: NF16537_low_17
Description: NF16537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16537_low_17
NF16537_low_17
[»] chr8 (1 HSPs)
chr8 (18-165)||(573244-573392)


Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 165
Target Start/End: Complemental strand, 573392 - 573244
Alignment:
Q  18 atgtttttggttcattgcttggaaagtagaattttgcttcggtgttgctttatgaaaatttacaaccatggggttgcttctctc-tttatgttccaagtc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||    
T  573392 atgtttttggttcattgcttggaaagtagaattttgcttcggtgttgttttatgaaaatttacaaccatggggttgcttctttcttttatgttccaagtc 573293  T
Q  117 tttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  573292 tttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca 573244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University