View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16536_high_9 (Length: 258)

Name: NF16536_high_9
Description: NF16536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16536_high_9
NF16536_high_9
[»] chr1 (1 HSPs)
chr1 (11-168)||(51094632-51094786)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 168
Target Start/End: Original strand, 51094632 - 51094786
Alignment:
Q  11 tataggttgtattggatggatccaaaacaatcgatcatccattaagaattcactaaaattgttcaaaaggaatcaattcaattcacctatcagcgattaa 110  Q
    |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    | |    
T  51094632 tataggttgtattggatggatcaaaaacaatcgattatccattaagaattcactaaaattgttcaaaaggaatcaattcaattcacctatcag----tga 51094727  T
Q  111 tatcctttcaatctatctatcagtgatttttgaatggatg-aataccctatcccttcaa 168  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||    
T  51094728 tatcctttcaatctatctattagtgatttttgaatggatgaaataccctatcccttcaa 51094786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University