View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16535_low_47 (Length: 230)

Name: NF16535_low_47
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16535_low_47
NF16535_low_47
[»] chr5 (1 HSPs)
chr5 (10-213)||(9247424-9247627)


Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 9247424 - 9247627
Alignment:
Q  10 tgaaatgaatgaaagtttacttattttcttagccactactaaaataattttattttatatttgagtacggacggaatactcatgtactactacaaataaa 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  9247424 tgaaatgaatgaaagtttacttattttcttagccactactaaaataattttattttatatctgagtacggacggaatactcatgtactactacaaataaa 9247523  T
Q  110 ctaatatgtatccatgattttattattaaaaataatttaattgataatgaaatgatggagaaaaatcgttttcaaaagatatacggtagatccaataagc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9247524 ctaatatgtatccatgattttattattaaaaataatttaattgataatgaaatgatggagaaaaatcgttttcaaaagatatacggtagatccaataagc 9247623  T
Q  210 atgc 213  Q
    ||||    
T  9247624 atgc 9247627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University