View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16533_low_86 (Length: 306)

Name: NF16533_low_86
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16533_low_86
NF16533_low_86
[»] scaffold0008 (3 HSPs)
scaffold0008 (13-132)||(49804-49923)
scaffold0008 (13-109)||(61997-62093)
scaffold0008 (227-282)||(49714-49769)
[»] chr2 (1 HSPs)
chr2 (45-107)||(21091607-21091669)


Alignment Details
Target: scaffold0008 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 13 - 132
Target Start/End: Complemental strand, 49923 - 49804
Alignment:
Q  13 atgccttgggaaatattttggtgttgttcatccttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtgagagat 112  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49923 atgcattgggaaatatcttggtgttgttcatccttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtgagagat 49824  T
Q  113 ctcagccatgctaaattaga 132  Q
    |||| |||||||||||||||    
T  49823 ctcaaccatgctaaattaga 49804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 62093 - 61997
Alignment:
Q  13 atgccttgggaaatattttggtgttgttcatccttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtgaga 109  Q
    |||| ||||||||||| |||||||||||  | || ||||||||||||||||| ||||||  |||||||||||||||||| |||||||||||||||||    
T  62093 atgcgttgggaaatatcttggtgttgtttcttctaggaggtatttttgcaggggtaacacttgattggttatggttaataggtaaaggatggtgaga 61997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 49769 - 49714
Alignment:
Q  227 tgaatatgtttagtgtttgcattttgtacaaagctaaatccaatttcggttaattt 282  Q
    ||||||||||| |||||| |||| |||||||||||||||||||||| |||||||||    
T  49769 tgaatatgtttggtgttttcattatgtacaaagctaaatccaattttggttaattt 49714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 107
Target Start/End: Original strand, 21091607 - 21091669
Alignment:
Q  45 cttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtga 107  Q
    ||||||||| |||||| ||| ||||||  ||| ||| |||||||||| |||||||||||||||    
T  21091607 cttggaggtctttttgtaggggtaacacttgactggctatggttaataggtaaaggatggtga 21091669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University