View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16533_low_69 (Length: 348)

Name: NF16533_low_69
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16533_low_69
NF16533_low_69
[»] chr2 (2 HSPs)
chr2 (283-340)||(33203363-33203420)
chr2 (283-340)||(33203430-33203487)


Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 33203363 - 33203420
Alignment:
Q  283 gactatttagataagctccatcacctcattctttgttgaaaccttcatccttcatctc 340  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||    
T  33203363 gactatttagataagcttcatcacctcattctttgttgaaaccttcatcattcatctc 33203420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 33203430 - 33203487
Alignment:
Q  283 gactatttagataagctccatcacctcattctttgttgaaaccttcatccttcatctc 340  Q
    ||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||    
T  33203430 gactacttagataagctccatcacctcattctctgttgaaaccttcatccttcgtctc 33203487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University