View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16533_low_149 (Length: 211)

Name: NF16533_low_149
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16533_low_149
NF16533_low_149
[»] chr5 (1 HSPs)
chr5 (18-188)||(16822461-16822631)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 16822631 - 16822461
Alignment:
Q  18 gaacacatacaatacaaagtaaagttaccctacacatcatggaatcgagagggctaaagaacacatgcattatacataaatttgttcccaattaatttgt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  16822631 gaacacatacaatacaaagtaaagttaccctacacatcatggaatcgagagggctaaagaacacatgcattatacataaatttgtccccaattaatttgt 16822532  T
Q  118 aatcaaaataattggtgaatagcttaatttgtatacaacatttagttaggtatacaaatactacagctacc 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16822531 aatcaaaataattggtgaatagcttaatttgtatacaacatttagttaggtatacaaatactacagctacc 16822461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University