View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16533_low_145 (Length: 213)

Name: NF16533_low_145
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16533_low_145
NF16533_low_145
[»] chr4 (1 HSPs)
chr4 (17-198)||(49014677-49014858)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 49014677 - 49014858
Alignment:
Q  17 taggagtacggagaatccaatttataatgtgatgggtgtgttcatccttcgagattgatttagccctggcatgggcagggctcgaggtatgacattatac 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49014677 taggagtacggagaatccaatttataatgtgatgggtgtgttcatccttcgagattgatttagccctggcatgggcagggctcgaggtatgacattatac 49014776  T
Q  117 attacaaagggacttcaataatttggtcaccttggtttatggtaagggaccagcgtttattttgcttgtggggacttcctat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49014777 attacaaagggacttcaataatttggtcaccttggtttatggtaagggaccagcgtttattttgcttgtggggacttcctat 49014858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University