View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16531_high_5 (Length: 223)

Name: NF16531_high_5
Description: NF16531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16531_high_5
NF16531_high_5
[»] chr3 (1 HSPs)
chr3 (19-207)||(42099134-42099326)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 42099326 - 42099134
Alignment:
Q  19 cagcattccccacaaaatatcagagcttccaagtcgattgatctctttatattgctacctagctatctcatatg--atctgattctgaatatcttatgaa 116  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||    
T  42099326 cagcattccccacaaaatatcagagcttccaagacgattgatctctttatattgctacctagctatctcatatataatctgattctgaatatcttatgaa 42099227  T
Q  117 tactct--aggtttcattttgcggtatattataaggaaatagtgcaatgatgaagataatcattaatttggttttaatagaaaagtaaaagta 207  Q
    ||||||  ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42099226 tactctctaggtttcgttttgcggtatattataaggaaatagtgcaatgatgaagataatcattaatttggttttaatagaaaagtaaaagta 42099134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University