View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16527_low_27 (Length: 243)

Name: NF16527_low_27
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16527_low_27
NF16527_low_27
[»] chr7 (1 HSPs)
chr7 (19-241)||(42862534-42862756)


Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 42862534 - 42862756
Alignment:
Q  19 tcgtcatggtatgaatatgattcataaacaccatgctttgctcttttacccttcacaacaaatatcttactccctctgttttcttttctatcatgtttcc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  42862534 tcgtcatggtatgaatatgattcataaacaccatgctttgctcttttacccttcacaacaaatatcttactccctctgttttcttttctatgatgtttcc 42862633  T
Q  119 ttttgcactcccttctccaccatgtgggatttggcttttgttttacaaatcctttgataggtgtttgttttaatagcacaaattgtttttaacatgtttg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42862634 ttttgcactcccttctccaccatgtgggatttggcttttgttttacaaatcctttgataggtgtttgttttaatagcacaaattgtttttaacatgtttg 42862733  T
Q  219 tgttgccattgaaaattatgctt 241  Q
    |||||||||||||||||||||||    
T  42862734 tgttgccattgaaaattatgctt 42862756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University