View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16527_high_2 (Length: 640)

Name: NF16527_high_2
Description: NF16527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16527_high_2
NF16527_high_2
[»] chr4 (1 HSPs)
chr4 (518-622)||(39145087-39145191)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 2e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 518 - 622
Target Start/End: Complemental strand, 39145191 - 39145087
Alignment:
Q  518 agtacgacgctgcatattgaaatacttgagaattacaagttcttgcatagatgaaaatatgtgttcgttaaagtgatgagctgagtgatgaataagaaga 617  Q
    ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39145191 agtacgacgctgcatattgaaatgcttgagaattacaagttcctgcatagatgaaaatatgtgttcgttaaagtgatgagctgagtgatgaataagaaga 39145092  T
Q  618 atctt 622  Q
    |||||    
T  39145091 atctt 39145087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University