View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16524_low_46 (Length: 223)

Name: NF16524_low_46
Description: NF16524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16524_low_46
NF16524_low_46
[»] chr4 (1 HSPs)
chr4 (19-208)||(55939905-55940094)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 55939905 - 55940094
Alignment:
Q  19 acttttattggaaagtgctagcaatcttaacatagaactggatgataatggatatggtacatgtggtaaaacttgattggtaagtcaggaaaatacctaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  55939905 acttttattggaaagtgctagcaatcttaacatagaactggatgataatggatatggtacatgtggtaaaacttgattagtaagtcaggaaaatacctaa 55940004  T
Q  119 agaatgagaagatatatattgctggatgtggctaaatgaaattcgaataaatatgtagaagtcaagaacagatcttttcgaacaagtata 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55940005 agaatgagaagatatatattgctggatgtggctaaatgaaattcgaataaatatgtagaagtcaagaacagatcttttcgaacaagtata 55940094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University