View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16523_low_18 (Length: 207)

Name: NF16523_low_18
Description: NF16523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16523_low_18
NF16523_low_18
[»] chr4 (2 HSPs)
chr4 (66-171)||(21239675-21239778)
chr4 (1-68)||(46034819-46034886)
[»] chr7 (1 HSPs)
chr7 (8-68)||(39488697-39488757)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 66 - 171
Target Start/End: Complemental strand, 21239778 - 21239675
Alignment:
Q  66 tggaatgcacactctcactagaaattgagcaaaaaattttgctcaatttctagtcaatgacaagagtgctcacaatagagtgacacttgtgttttattta 165  Q
    ||||||||||||||  ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||     
T  21239778 tggaatgcacactc--actagaaattgagcaaaaagttttgctcaatttctaatcaatgacaagagtgctcacaatagagtgacacttgtgttttatttt 21239681  T
Q  166 taatgt 171  Q
    ||||||    
T  21239680 taatgt 21239675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 46034886 - 46034819
Alignment:
Q  1 cagctagatttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttgatgg 68  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  46034886 cagccagatttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatgg 46034819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 39488757 - 39488697
Alignment:
Q  8 atttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttgatgg 68  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  39488757 atttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatgg 39488697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University