View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16523_high_15 (Length: 214)

Name: NF16523_high_15
Description: NF16523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16523_high_15
NF16523_high_15
[»] chr4 (1 HSPs)
chr4 (23-199)||(35250437-35250613)
[»] chr1 (1 HSPs)
chr1 (98-132)||(27780727-27780761)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 199
Target Start/End: Original strand, 35250437 - 35250613
Alignment:
Q  23 atatccatatatctttttctccagagtgcctgtcgtttcttgggcggtagaaactgatcatcaatggaagatgggagcgcatgccgtttcttgggtggta 122  Q
    |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35250437 atatccatatatctttttctccagagcgcctgccgtttcttgggcggtagaaactgatcatcaatggaagatgggagcgcatgccgtttcttgggtggta 35250536  T
Q  123 gaaactgatcctcaatggaagatggtgctgcagttggtgtgttagtaataccgttttgagagtgacacctcttatgt 199  Q
    |||||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  35250537 gaaactgatcatcaatggaagacggtgctgtagttggtgtgttagtaataccgttttgagagtgacacctcttatgt 35250613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 132
Target Start/End: Complemental strand, 27780761 - 27780727
Alignment:
Q  98 agcgcatgccgtttcttgggtggtagaaactgatc 132  Q
    ||||| |||||||||||||||||||||||||||||    
T  27780761 agcgcctgccgtttcttgggtggtagaaactgatc 27780727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University