View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16521_low_68 (Length: 268)

Name: NF16521_low_68
Description: NF16521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16521_low_68
NF16521_low_68
[»] chr8 (2 HSPs)
chr8 (168-245)||(3688727-3688804)
chr8 (1-43)||(3688933-3688975)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 168 - 245
Target Start/End: Complemental strand, 3688804 - 3688727
Alignment:
Q  168 ttcaccttcacgagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttcacttttcc 245  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  3688804 ttcaccttcaggagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttgacttttcc 3688727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 3688975 - 3688933
Alignment:
Q  1 caaacaaataccaagaaaatgtcataatttggtttttatattt 43  Q
    ||||||||||||||||||||||||||||||| |||||||||||    
T  3688975 caaacaaataccaagaaaatgtcataatttgatttttatattt 3688933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University