View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16515_low_72 (Length: 265)

Name: NF16515_low_72
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16515_low_72
NF16515_low_72
[»] chr6 (2 HSPs)
chr6 (69-192)||(33604485-33604609)
chr6 (217-250)||(33604433-33604466)


Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 69 - 192
Target Start/End: Complemental strand, 33604609 - 33604485
Alignment:
Q  69 ctgaaaatagtaagagctcgcctttaaaccgttaaaacccttgattgtgtgttccattgcttaaa-tcaaactagatattcaaaatctctagtttaatat 167  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||    
T  33604609 ctgaaaatagtaagagctcacctttaaaccgttaaaacccttgattgtgtgttccattgcttaaattcaaactagatattcaaagtctctagtttaatat 33604510  T
Q  168 ttaacgaaaattcaaaaattacatc 192  Q
    |||||||||||||||||||||||||    
T  33604509 ttaacgaaaattcaaaaattacatc 33604485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 217 - 250
Target Start/End: Complemental strand, 33604466 - 33604433
Alignment:
Q  217 aaagaaacatcatatgttctattactcaaatttt 250  Q
    ||||||||||||||||||||||| ||||||||||    
T  33604466 aaagaaacatcatatgttctattgctcaaatttt 33604433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University