View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16515_low_63 (Length: 287)

Name: NF16515_low_63
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16515_low_63
NF16515_low_63
[»] chr7 (1 HSPs)
chr7 (192-280)||(31223744-31223832)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 192 - 280
Target Start/End: Original strand, 31223744 - 31223832
Alignment:
Q  192 caacctttcttatacttctgatttctcaggaccatttatttactatattttccccaaatcaagatacattgtatttgtcacctatgctt 280  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  31223744 caaccattcttatacttctgatttctcaggaccatttatttactatattttccccaaatcaagatacattgtatttgtcacctttgctt 31223832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University