View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16515_high_87 (Length: 217)

Name: NF16515_high_87
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16515_high_87
NF16515_high_87
[»] chr4 (2 HSPs)
chr4 (14-217)||(42393945-42394148)
chr4 (18-217)||(42378027-42378229)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 42394148 - 42393945
Alignment:
Q  14 catagggaagccgaacttgtcggannnnnnncctgcgttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgat 113  Q
    ||||||||||||||||||||| ||       |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42394148 catagggaagccgaacttgtcagatttttttcctgcgctggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgat 42394049  T
Q  114 ggaatatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggagagtgaaagtaaggattttttgcagtttttgttgaatttgaagg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42394048 ggaatatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggagagtgaaagtaaggattttttgcagtttttgttgaatttgaagg 42393949  T
Q  214 agga 217  Q
    ||||    
T  42393948 agga 42393945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 42378229 - 42378027
Alignment:
Q  18 gggaagccgaacttgtcggannnnnnncctgcgttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgatggaa 117  Q
    ||||||||||| ||||||||       |||| |||||| |||||||||||||||||| |||||||||||||||||  |||||||||||| |||||||| |    
T  42378229 gggaagccgaatttgtcggatttttttcctgggttggcccggtttgatttgcagggtgttgtgaaagatatgaatgctttggtgcctcgctttgatggga 42378130  T
Q  118 tatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggag---agtgaaagtaaggattttttgcagtttttgttgaatttgaagga 214  Q
    ||||||| |||||||||||||||||| ||  |||||| |  || || ||||||   | ||  |||| ||| ||| |||||||||||||||||||||||||    
T  42378129 tatttgagaagatgattggtgaacgattgaagaaggaagaggatgggaaggagaataatgggagtagggactttctgcagtttttgttgaatttgaagga 42378030  T
Q  215 gga 217  Q
    |||    
T  42378029 gga 42378027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University