View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16514_low_24 (Length: 243)

Name: NF16514_low_24
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16514_low_24
NF16514_low_24
[»] chr8 (2 HSPs)
chr8 (47-147)||(7314257-7314357)
chr8 (190-241)||(7314351-7314402)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 47 - 147
Target Start/End: Original strand, 7314257 - 7314357
Alignment:
Q  47 gatagggttccatgcggtaagatgggttggagtgagagaaggaagagagagatatatacttgcggtttggagacggcgcgcggtgttgtggtggagaaga 146  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||    
T  7314257 gatagggttccatgcggtaagatgggttggagtgagagaaggaagagagagatatatacttgcggtttggagacggcgcgcggttttgtggtggaggaga 7314356  T
Q  147 a 147  Q
    |    
T  7314357 a 7314357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 7314351 - 7314402
Alignment:
Q  190 aggagcagaggttttcactttttgatggagaagagctacacgtacgattgcc 241  Q
    ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||    
T  7314351 aggagaagaggttttcagtttttgatggagaagagctacacatacgattgcc 7314402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University