View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16511_low_42 (Length: 235)

Name: NF16511_low_42
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16511_low_42
NF16511_low_42
[»] chr4 (2 HSPs)
chr4 (87-207)||(42003624-42003744)
chr4 (15-45)||(42003536-42003566)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 87 - 207
Target Start/End: Original strand, 42003624 - 42003744
Alignment:
Q  87 gagaattacagattcaaacgtacgtctcaatggtcttgccacctaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaac 186  Q
    ||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42003624 gagaattacagattcaaacgtacgtcttaacggtcttgccacttaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaac 42003723  T
Q  187 gtagtggttaggttaatattt 207  Q
    |||||||||||||||||||||    
T  42003724 gtagtggttaggttaatattt 42003744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 45
Target Start/End: Original strand, 42003536 - 42003566
Alignment:
Q  15 gagaagaattggatgaatggtaattccatgc 45  Q
    |||||||||||||||||||||||||||||||    
T  42003536 gagaagaattggatgaatggtaattccatgc 42003566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University