View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16511_high_20 (Length: 375)

Name: NF16511_high_20
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16511_high_20
NF16511_high_20
[»] chr4 (1 HSPs)
chr4 (256-375)||(25475877-25475996)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 256 - 375
Target Start/End: Complemental strand, 25475996 - 25475877
Alignment:
Q  256 tctccataggtaccacaattgtcgcatatgatctcccccatctctaatccatggatcataccatcctcttattctcgacccatcatcaactctcaattta 355  Q
    |||||||||||||| ||  |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25475996 tctccataggtaccgcaggtgtcacatatgatctcccccatctctaatccatggatcataccatcctcttattctcgacccatcatcaactctcaattta 25475897  T
Q  356 aggtctcctctaactactac 375  Q
    |||||| |||||||||||||    
T  25475896 aggtcttctctaactactac 25475877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University