View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16510_low_13 (Length: 261)

Name: NF16510_low_13
Description: NF16510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16510_low_13
NF16510_low_13
[»] chr8 (1 HSPs)
chr8 (1-198)||(423607-423808)


Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 423808 - 423607
Alignment:
Q  1 tctcattcatattatagtcatagtcatagctagccagccagacatatatgaattaatcatgacgatcatctgacctgggtaccactgatcatcaaacaga 100  Q
    |||||||||||| ||||||||||   |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  423808 tctcattcatatcatagtcatagc--tagccagccagccagacatatatgaattaatcatgacgatcatctgacctgggtaccactgatcatcaaacaga 423711  T
Q  101 ccaaactcaaaacagattgtgggtcccatctaatttaatgtctcagatt------attaaccccatccaatccattctcacccgttcactgtccttgttt 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||    
T  423710 ccaaactcaaaacagattgtgggtcccatctaatttaatgtctcagattattattattaaccccatccaatccattctcacccgttcactgtccttgttt 423611  T
Q  195 atta 198  Q
    ||||    
T  423610 atta 423607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University