View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16509_low_8 (Length: 227)

Name: NF16509_low_8
Description: NF16509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16509_low_8
NF16509_low_8
[»] chr5 (1 HSPs)
chr5 (39-221)||(988219-988401)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 39 - 221
Target Start/End: Complemental strand, 988401 - 988219
Alignment:
Q  39 atgttaaatcaagagtcacatatctcataccaaatcagtgtgtcactatccataatagacacgttgtttatgttattgtttgcatgtctcctcttggtaa 138  Q
    |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  988401 atgttaaatcaagagtcacatatctcatactaaatcagtgtgtaactatccataatagacccgttgtttatgttattgtttgcatgtctcctcttggtaa 988302  T
Q  139 ttatcaatcttttgctgttaaatatgtgtcattaactctttcattcgactgaaatgtttttatcaaatgtggcaagttagaaa 221  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  988301 ttatcaatcttttgctgtaaaatatgtgtcattaactctttcattcgagtgaaatgtttttatcaaatgtggcaagttagaaa 988219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University