View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16508_low_49 (Length: 210)

Name: NF16508_low_49
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16508_low_49
NF16508_low_49
[»] chr3 (1 HSPs)
chr3 (39-178)||(49216822-49216957)
[»] chr4 (1 HSPs)
chr4 (148-196)||(32369136-32369187)


Alignment Details
Target: chr3 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 39 - 178
Target Start/End: Original strand, 49216822 - 49216957
Alignment:
Q  39 aattgttgagttttggatgaattgttaccactcttgaaattcatgatgaagcacacaacaaaagaagnnnnnnnntagaagaagcaaagttggaatggaa 138  Q
    ||||||||||||||||||||||||||||||||  | ||||| ||||||||| ||||||||||||||         ||||||||||||||||| ||||| |    
T  49216822 aattgttgagttttggatgaattgttaccactgataaaattgatgatgaagtacacaacaaaagaa----aaaaatagaagaagcaaagttgaaatggca 49216917  T
Q  139 gcaatagaggaagaaattgttactgttgaaattgatgatg 178  Q
    | || |||||||||||||||||| ||||||||||||||||    
T  49216918 ggaagagaggaagaaattgttaccgttgaaattgatgatg 49216957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 32369187 - 32369136
Alignment:
Q  148 gaagaaattgttac---tgttgaaattgatgatgagacttatgaagaaattg 196  Q
    ||||||||||||||   ||||||||||||||||||||| |||||||||||||    
T  32369187 gaagaaattgttacaactgttgaaattgatgatgagacatatgaagaaattg 32369136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University