View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16508_low_26 (Length: 298)

Name: NF16508_low_26
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16508_low_26
NF16508_low_26
[»] chr8 (2 HSPs)
chr8 (1-284)||(1763076-1763359)
chr8 (42-213)||(25197611-25197782)
[»] scaffold0147 (2 HSPs)
scaffold0147 (14-208)||(10409-10603)
scaffold0147 (248-284)||(10333-10369)
[»] chr7 (2 HSPs)
chr7 (42-222)||(19208135-19208315)
chr7 (248-284)||(19208073-19208109)


Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 1763359 - 1763076
Alignment:
Q  1 caaccatagctagatgctgtcctaaacatacacgaggtcccattccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1763359 caaccatagctagatgctgtcctaaacatacacgaggtcccattccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaa 1763260  T
Q  101 tctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttgg 200  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1763259 tctttccggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttgg 1763160  T
Q  201 atacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1763159 atacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc 1763076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 213
Target Start/End: Complemental strand, 25197782 - 25197611
Alignment:
Q  42 attccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagct 141  Q
    |||||||||||||| ||| ||||||||| |||||| | |||| |||| ||||||| ||||||||| || ||||| |  ||||||||    ||||| |  |    
T  25197782 attccaaatggcatataagcttgtggaaacttgcaggatccaagcacaccatttgaaaatctttcaggtttgaattcgtgtgcatcgaccccccatatat 25197683  T
Q  142 ctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttggatacctttgaaat 213  Q
    |   |||||  || ||||| || |||||||| |||| | | |||||||||||||||| ||||||||| ||||    
T  25197682 ccttgtcttcctgaaatatcgggattggaatctgaatagtgattccttttggaattttgataccttttaaat 25197611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0147 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: scaffold0147
Description:

Target: scaffold0147; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 10603 - 10409
Alignment:
Q  14 atgctgtcctaaacatacacgaggtcccattccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaatctttctggattg 113  Q
    ||||||||||  ||| |||||||  || |||||||||||||| ||| |||||||||||||||| |||| | |||| ||||||||||||||||| ||||||    
T  10603 atgctgtcctggacagacacgagaaccgattccaaatggcatataagcttgtggaatcttgcaggctctaagcacaccatttgcaaatctttcaggattg 10504  T
Q  114 aacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttggataccttt 208  Q
    ||||  ||||||||    |||||||  ||   ||| || ||||||||||| |||||||| |||| ||||||||||||||||| || |||||||||    
T  10503 aactcgtgtgcatcggccccccaaatatcaatgtcatgctgcaatattgggattggaatctgaatattcattccttttggaactttgataccttt 10409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0147; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 284
Target Start/End: Complemental strand, 10369 - 10333
Alignment:
Q  248 tgctggtggataaagcctcaatgtctcttgaatcacc 284  Q
    |||||| |||||||||||||| |||||||||||||||    
T  10369 tgctggcggataaagcctcaaagtctcttgaatcacc 10333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 42 - 222
Target Start/End: Complemental strand, 19208315 - 19208135
Alignment:
Q  42 attccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagct 141  Q
    |||||||||||||| ||| |||||||||||||||| |||||| |||| ||||||||||||||||| ||||||||||  ||||||||  | ||||| |  |    
T  19208315 attccaaatggcatataagcttgtggaatcttgcaggctccaagcacaccatttgcaaatctttcaggattgaactcgtgtgcatcgggcccccagatat 19208216  T
Q  142 ctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttggatacctttgaaattaatgtctt 222  Q
    |   |||||| |||||||| |  |||||||| || | ||| ||||||||||||| || ||||||||| |||||||| ||||    
T  19208215 caatgtcttgttgcaatatcgcaattggaatctgcatattaattccttttggaactttgataccttttaaattaatatctt 19208135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 284
Target Start/End: Complemental strand, 19208109 - 19208073
Alignment:
Q  248 tgctggtggataaagcctcaatgtctcttgaatcacc 284  Q
    ||||||||||||||||||||| |||||||||||||||    
T  19208109 tgctggtggataaagcctcaaagtctcttgaatcacc 19208073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University