View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16504_high_34 (Length: 321)

Name: NF16504_high_34
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16504_high_34
NF16504_high_34
[»] chr6 (182 HSPs)
chr6 (90-308)||(27624048-27624264)
chr6 (90-308)||(27284701-27284917)
chr6 (90-305)||(13518533-13518744)
chr6 (90-305)||(13293285-13293501)
chr6 (90-305)||(4763409-4763622)
chr6 (90-305)||(16938365-16938577)
chr6 (90-305)||(27013378-27013591)
chr6 (90-305)||(29555204-29555416)
chr6 (90-305)||(4718475-4718685)
chr6 (90-305)||(24869356-24869568)
chr6 (90-305)||(26926416-26926628)
chr6 (90-305)||(27063129-27063339)
chr6 (90-305)||(28213100-28213312)
chr6 (90-305)||(29507062-29507274)
chr6 (90-305)||(34458846-34459056)
chr6 (90-305)||(28166137-28166352)
chr6 (90-305)||(4778526-4778738)
chr6 (90-305)||(8900039-8900253)
chr6 (90-305)||(22929222-22929434)
chr6 (90-305)||(23851667-23851879)
chr6 (90-305)||(27199831-27200044)
chr6 (90-305)||(27249190-27249403)
chr6 (90-305)||(27264454-27264664)
chr6 (90-305)||(29578660-29578873)
chr6 (90-305)||(4530931-4531146)
chr6 (90-305)||(26110750-26110962)
chr6 (90-305)||(26791462-26791674)
chr6 (90-305)||(27030669-27030879)
chr6 (90-305)||(27356451-27356660)
chr6 (90-305)||(27490779-27490991)
chr6 (90-305)||(16679786-16679997)
chr6 (90-305)||(27184575-27184786)
chr6 (90-305)||(24300095-24300307)
chr6 (90-305)||(33370771-33370981)
chr6 (90-305)||(14139734-14139944)
chr6 (90-305)||(16755467-16755678)
chr6 (90-305)||(26772968-26773177)
chr6 (90-306)||(20174192-20174407)
chr6 (90-306)||(22161584-22161799)
chr6 (90-305)||(15406869-15407083)
chr6 (90-305)||(15418656-15418870)
chr6 (90-305)||(30552356-30552566)
chr6 (161-308)||(27024780-27024927)
chr6 (156-305)||(4540175-4540324)
chr6 (17-90)||(29402191-29402264)
chr6 (163-308)||(18210101-18210246)
chr6 (163-308)||(21363070-21363215)
chr6 (163-308)||(23967052-23967197)
chr6 (165-308)||(18122088-18122231)
chr6 (163-308)||(25709573-25709720)
chr6 (163-308)||(27547521-27547668)
chr6 (165-241)||(25710269-25710345)
chr6 (165-241)||(27548259-27548335)
chr6 (90-145)||(4540099-4540153)
chr6 (158-244)||(16584636-16584723)
chr6 (158-244)||(16610657-16610744)
chr6 (158-241)||(27515738-27515821)
chr6 (158-244)||(18752933-18753019)
chr6 (158-242)||(16639612-16639697)
chr6 (162-206)||(27623314-27623358)
chr6 (158-244)||(174323-174410)
chr6 (158-244)||(27053474-27053561)
chr6 (158-244)||(15648234-15648320)
chr6 (163-241)||(27200632-27200710)
chr6 (163-241)||(27248523-27248601)
chr6 (163-241)||(27491578-27491656)
chr6 (163-204)||(4539366-4539407)
chr6 (163-204)||(8899307-8899348)
chr6 (163-244)||(8899373-8899454)
chr6 (163-262)||(9133783-9133884)
chr6 (163-204)||(14139008-14139049)
chr6 (163-204)||(15406141-15406182)
chr6 (163-204)||(15417928-15417969)
chr6 (163-204)||(16680688-16680729)
chr6 (163-204)||(16937633-16937674)
chr6 (163-204)||(22928488-22928529)
chr6 (163-204)||(24299368-24299409)
chr6 (163-204)||(26110017-26110058)
chr6 (163-204)||(26666266-26666307)
chr6 (163-204)||(26772237-26772278)
chr6 (163-204)||(26927301-26927342)
chr6 (163-204)||(27014275-27014316)
chr6 (163-204)||(27031569-27031610)
chr6 (163-204)||(27064030-27064071)
chr6 (163-244)||(27070573-27070654)
chr6 (163-204)||(27209449-27209490)
chr6 (163-204)||(27239738-27239779)
chr6 (163-204)||(27491681-27491722)
chr6 (163-204)||(28167044-28167085)
chr6 (163-204)||(28214004-28214045)
chr6 (163-204)||(29507967-29508008)
chr6 (163-204)||(29579563-29579604)
chr6 (163-204)||(30551608-30551649)
chr6 (163-204)||(33370039-33370080)
chr6 (165-244)||(22775499-22775578)
chr6 (158-244)||(28308741-28308828)
chr6 (163-241)||(4779327-4779405)
chr6 (163-241)||(13517868-13517946)
chr6 (163-241)||(27355785-27355863)
chr6 (163-241)||(28166941-28167019)
chr6 (163-241)||(29507864-29507942)
chr6 (163-201)||(34458116-34458154)
chr6 (163-204)||(4531837-4531878)
chr6 (163-204)||(4764312-4764353)
chr6 (163-204)||(4779430-4779471)
chr6 (163-204)||(13292557-13292598)
chr6 (163-204)||(13517802-13517843)
chr6 (163-204)||(16756370-16756411)
chr6 (167-204)||(24870254-24870291)
chr6 (163-204)||(26792365-26792406)
chr6 (90-131)||(27024962-27025003)
chr6 (163-204)||(27025691-27025732)
chr6 (163-204)||(27200736-27200777)
chr6 (163-204)||(27248456-27248497)
chr6 (163-204)||(27355719-27355760)
chr6 (163-244)||(30551674-30551755)
chr6 (158-201)||(18209466-18209509)
chr6 (165-244)||(19717332-19717411)
chr6 (158-205)||(20052568-20052615)
chr6 (158-201)||(21362458-21362501)
chr6 (158-241)||(22774807-22774890)
chr6 (158-201)||(23966440-23966483)
chr6 (163-206)||(27283970-27284013)
chr6 (163-241)||(4531734-4531812)
chr6 (163-241)||(4539432-4539510)
chr6 (163-241)||(4764209-4764287)
chr6 (163-241)||(13292623-13292701)
chr6 (163-241)||(14139074-14139152)
chr6 (163-241)||(16680585-16680663)
chr6 (163-241)||(16756267-16756345)
chr6 (163-241)||(24299434-24299512)
chr6 (163-241)||(24870151-24870229)
chr6 (163-241)||(26110083-26110161)
chr6 (163-241)||(27014172-27014250)
chr6 (163-241)||(27025587-27025665)
chr6 (163-241)||(27209346-27209424)
chr6 (163-241)||(27239804-27239882)
chr6 (163-241)||(28213901-28213979)
chr6 (163-241)||(33370105-33370183)
chr6 (163-241)||(34458182-34458260)
chr6 (157-206)||(617722-617771)
chr6 (165-206)||(16584828-16584869)
chr6 (165-206)||(16610511-16610552)
chr6 (165-206)||(18752872-18752913)
chr6 (157-206)||(20042454-20042503)
chr6 (163-204)||(20175111-20175152)
chr6 (163-204)||(22160839-22160880)
chr6 (165-206)||(27053410-27053451)
chr6 (165-206)||(27069791-27069832)
chr6 (157-206)||(27515909-27515958)
chr6 (165-206)||(28308849-28308890)
chr6 (167-204)||(29556107-29556144)
chr6 (165-244)||(5991773-5991853)
chr6 (163-227)||(20053280-20053344)
chr6 (165-244)||(25501206-25501286)
chr6 (164-244)||(26666333-26666413)
chr6 (164-244)||(26772304-26772384)
chr6 (158-206)||(27515841-27515889)
chr6 (158-205)||(617790-617837)
chr6 (158-201)||(18122852-18122895)
chr6 (158-205)||(18439252-18439299)
chr6 (158-205)||(20042520-20042567)
chr6 (165-204)||(21362394-21362433)
chr6 (165-204)||(23966376-23966415)
chr6 (158-205)||(24145320-24145367)
chr6 (165-228)||(27515053-27515116)
chr6 (156-206)||(174433-174483)
chr6 (163-241)||(15406207-15406285)
chr6 (163-241)||(15417994-15418072)
chr6 (163-241)||(26792262-26792340)
chr6 (163-241)||(26927198-26927276)
chr6 (163-241)||(27031466-27031544)
chr6 (158-200)||(27052445-27052487)
chr6 (163-241)||(27063927-27064005)
chr6 (163-241)||(29579460-29579538)
chr6 (165-206)||(16584746-16584787)
chr6 (165-206)||(16610593-16610634)
chr6 (158-242)||(16640583-16640668)
chr6 (163-244)||(16937699-16937780)
chr6 (165-206)||(24145261-24145302)
chr6 (163-240)||(29556005-29556082)
chr6 (164-244)||(23878677-23878756)
[»] chr5 (210 HSPs)
chr5 (90-305)||(13181082-13181297)
chr5 (90-305)||(43083911-43084126)
chr5 (90-308)||(25270086-25270303)
chr5 (90-305)||(30157687-30157901)
chr5 (90-305)||(33880784-33880995)
chr5 (90-308)||(25205931-25206147)
chr5 (90-305)||(9545001-9545213)
chr5 (90-305)||(13436974-13437187)
chr5 (90-308)||(23897528-23897743)
chr5 (90-305)||(30035084-30035295)
chr5 (90-305)||(31437120-31437332)
chr5 (90-305)||(37746620-37746833)
chr5 (90-305)||(40467846-40468054)
chr5 (90-304)||(24975504-24975717)
chr5 (90-305)||(6879961-6880171)
chr5 (90-305)||(8659765-8659979)
chr5 (90-305)||(13319120-13319334)
chr5 (90-305)||(23631625-23631837)
chr5 (90-305)||(24729625-24729838)
chr5 (90-305)||(34622174-34622386)
chr5 (90-305)||(33783141-33783355)
chr5 (90-305)||(11329293-11329505)
chr5 (90-305)||(12137831-12138044)
chr5 (90-305)||(15653051-15653261)
chr5 (90-305)||(15753144-15753356)
chr5 (90-305)||(28654899-28655110)
chr5 (90-305)||(32590568-32590778)
chr5 (90-305)||(37352937-37353147)
chr5 (90-305)||(37760639-37760850)
chr5 (90-305)||(18495060-18495276)
chr5 (90-305)||(28954073-28954289)
chr5 (90-308)||(22894064-22894285)
chr5 (90-305)||(26486050-26486264)
chr5 (90-305)||(3795197-3795406)
chr5 (90-305)||(9323132-9323345)
chr5 (90-305)||(18122709-18122920)
chr5 (90-305)||(18369825-18370038)
chr5 (90-305)||(30174125-30174333)
chr5 (90-305)||(31820701-31820911)
chr5 (90-305)||(37665779-37665990)
chr5 (90-305)||(41680361-41680572)
chr5 (90-296)||(24607910-24608114)
chr5 (90-303)||(33298186-33298401)
chr5 (90-305)||(2516718-2516933)
chr5 (90-305)||(11555011-11555222)
chr5 (90-305)||(22993409-22993621)
chr5 (90-305)||(30940291-30940504)
chr5 (90-305)||(33522036-33522247)
chr5 (156-305)||(5643444-5643593)
chr5 (179-308)||(29885575-29885704)
chr5 (163-308)||(3481589-3481734)
chr5 (163-308)||(20375015-20375162)
chr5 (163-261)||(5437611-5437710)
chr5 (163-261)||(11941808-11941907)
chr5 (158-243)||(21862452-21862538)
chr5 (90-145)||(5643616-5643670)
chr5 (158-244)||(21990740-21990827)
chr5 (158-244)||(27228714-27228801)
chr5 (163-291)||(15782109-15782239)
chr5 (163-291)||(31522953-31523082)
chr5 (165-244)||(12175675-12175755)
chr5 (163-309)||(17959725-17959873)
chr5 (158-244)||(11808515-11808602)
chr5 (158-244)||(26084454-26084541)
chr5 (158-244)||(28849200-28849287)
chr5 (158-241)||(29899076-29899159)
chr5 (163-261)||(36373346-36373445)
chr5 (163-261)||(36998000-36998099)
chr5 (163-204)||(2517625-2517666)
chr5 (163-204)||(6880863-6880904)
chr5 (163-204)||(9324035-9324076)
chr5 (163-204)||(9544268-9544309)
chr5 (163-204)||(11555912-11555953)
chr5 (163-204)||(12138734-12138775)
chr5 (163-204)||(13180354-13180395)
chr5 (163-204)||(13318389-13318430)
chr5 (163-204)||(15652322-15652363)
chr5 (163-204)||(18369093-18369134)
chr5 (163-204)||(18494329-18494370)
chr5 (163-204)||(22992685-22992726)
chr5 (163-204)||(23632530-23632571)
chr5 (163-204)||(23726794-23726835)
chr5 (163-204)||(24730529-24730570)
chr5 (163-204)||(24976402-24976443)
chr5 (163-204)||(25206843-25206884)
chr5 (163-204)||(25270999-25271040)
chr5 (163-204)||(26486944-26486985)
chr5 (163-204)||(28953339-28953380)
chr5 (163-204)||(30175025-30175066)
chr5 (163-204)||(30941190-30941231)
chr5 (163-204)||(31438016-31438057)
chr5 (163-204)||(33299096-33299137)
chr5 (163-244)||(33522836-33522917)
chr5 (163-204)||(37352205-37352246)
chr5 (163-204)||(40467112-40467153)
chr5 (163-204)||(41681264-41681305)
chr5 (163-204)||(43084816-43084857)
chr5 (158-244)||(20382387-20382474)
chr5 (165-244)||(21692651-21692730)
chr5 (165-204)||(23898428-23898467)
chr5 (158-244)||(33839997-33840084)
chr5 (163-241)||(3795995-3796073)
chr5 (163-201)||(3796101-3796139)
chr5 (163-241)||(6880760-6880838)
chr5 (163-241)||(15752485-15752563)
chr5 (163-241)||(18369159-18369237)
chr5 (163-241)||(23632427-23632505)
chr5 (163-241)||(28655699-28655777)
chr5 (163-241)||(30035882-30035960)
chr5 (163-241)||(30158490-30158568)
chr5 (163-241)||(32589903-32589981)
chr5 (163-241)||(33881582-33881660)
chr5 (163-241)||(41681161-41681239)
chr5 (163-204)||(8659033-8659074)
chr5 (163-204)||(11330198-11330239)
chr5 (163-204)||(13436231-13436272)
chr5 (163-204)||(15752419-15752460)
chr5 (165-241)||(20374383-20374460)
chr5 (163-204)||(28655802-28655843)
chr5 (163-204)||(30035985-30036026)
chr5 (163-204)||(30158593-30158634)
chr5 (163-204)||(31819974-31820015)
chr5 (163-204)||(33522942-33522983)
chr5 (163-204)||(33881685-33881726)
chr5 (163-204)||(34623079-34623120)
chr5 (163-244)||(37352271-37352352)
chr5 (163-204)||(37665046-37665087)
chr5 (163-204)||(37761539-37761580)
chr5 (177-260)||(34471297-34471381)
chr5 (158-244)||(24959875-24959962)
chr5 (165-244)||(37582505-37582584)
chr5 (163-241)||(5644254-5644332)
chr5 (163-241)||(8659099-8659177)
chr5 (163-241)||(9323932-9324010)
chr5 (163-241)||(9544334-9544412)
chr5 (163-241)||(11330095-11330173)
chr5 (163-241)||(12138631-12138709)
chr5 (163-241)||(13180420-13180498)
chr5 (163-241)||(13318455-13318533)
chr5 (163-241)||(15652387-15652465)
chr5 (163-241)||(18122043-18122121)
chr5 (163-241)||(18494395-18494473)
chr5 (163-241)||(22894872-22894950)
chr5 (163-201)||(22894978-22895016)
chr5 (163-233)||(22953997-22954067)
chr5 (163-241)||(23898325-23898403)
chr5 (163-241)||(24608697-24608775)
chr5 (163-241)||(24730426-24730504)
chr5 (163-241)||(25206740-25206818)
chr5 (163-241)||(25270896-25270974)
chr5 (163-241)||(26486841-26486919)
chr5 (163-241)||(30174922-30175000)
chr5 (163-241)||(30941086-30941164)
chr5 (163-241)||(33783938-33784016)
chr5 (163-241)||(37665113-37665191)
chr5 (163-241)||(37745949-37746027)
chr5 (163-241)||(43084713-43084791)
chr5 (220-308)||(349655-349746)
chr5 (157-206)||(1803789-1803838)
chr5 (163-204)||(5644357-5644398)
chr5 (157-206)||(7792487-7792536)
chr5 (165-206)||(11808451-11808492)
chr5 (157-206)||(12389769-12389818)
chr5 (157-206)||(15781324-15781373)
chr5 (165-206)||(20382509-20382550)
chr5 (157-206)||(21693467-21693516)
chr5 (165-206)||(21862384-21862425)
chr5 (163-204)||(24608800-24608841)
chr5 (165-206)||(26084390-26084431)
chr5 (165-206)||(27228650-27228691)
chr5 (165-206)||(28849307-28849348)
chr5 (163-244)||(28953405-28953486)
chr5 (157-206)||(31523807-31523856)
chr5 (163-204)||(32589838-32589878)
chr5 (163-204)||(33784041-33784082)
chr5 (165-206)||(33839934-33839975)
chr5 (157-206)||(36372617-36372666)
chr5 (157-206)||(36997280-36997329)
chr5 (163-204)||(37745883-37745924)
chr5 (165-241)||(12389840-12389916)
chr5 (158-205)||(1803725-1803772)
chr5 (158-201)||(3480908-3480951)
chr5 (158-205)||(7256580-7256627)
chr5 (158-205)||(7792423-7792470)
chr5 (158-205)||(11941142-11941189)
chr5 (158-205)||(15781388-15781435)
chr5 (158-205)||(31523740-31523787)
chr5 (158-205)||(36372683-36372730)
chr5 (165-244)||(36451941-36452020)
chr5 (158-205)||(36997346-36997393)
chr5 (163-241)||(2517522-2517600)
chr5 (163-241)||(11555809-11555887)
chr5 (163-241)||(13436297-13436375)
chr5 (163-241)||(22992751-22992829)
chr5 (163-241)||(24976299-24976377)
chr5 (158-200)||(27227697-27227739)
chr5 (163-241)||(31437913-31437991)
chr5 (163-241)||(31820037-31820115)
chr5 (163-241)||(33298993-33299071)
chr5 (157-206)||(7256515-7256564)
chr5 (165-226)||(7257278-7257339)
chr5 (164-201)||(11807500-11807537)
chr5 (165-206)||(11941085-11941126)
chr5 (164-201)||(12174688-12174725)
chr5 (158-195)||(23641605-23641642)
chr5 (165-206)||(23641665-23641706)
chr5 (165-206)||(23831175-23831216)
chr5 (158-195)||(23831239-23831276)
chr5 (177-260)||(24064566-24064651)
chr5 (164-201)||(26083414-26083451)
[»] chr3 (242 HSPs)
chr3 (90-308)||(19700096-19700311)
chr3 (90-308)||(15887143-15887358)
chr3 (90-305)||(47029063-47029277)
chr3 (90-308)||(16421792-16422008)
chr3 (90-305)||(5472598-5472812)
chr3 (90-305)||(5716684-5716892)
chr3 (90-305)||(5764566-5764774)
chr3 (90-305)||(18230806-18231017)
chr3 (90-308)||(4689262-4689474)
chr3 (90-308)||(16618928-16619143)
chr3 (90-305)||(5019324-5019537)
chr3 (90-305)||(5603751-5603964)
chr3 (90-305)||(5727594-5727802)
chr3 (90-305)||(18248351-18248562)
chr3 (90-305)||(29143193-29143406)
chr3 (90-305)||(31958893-31959105)
chr3 (90-305)||(48471537-48471751)
chr3 (90-305)||(51787633-51787846)
chr3 (90-305)||(4341113-4341326)
chr3 (90-305)||(4629395-4629609)
chr3 (90-305)||(5657747-5657959)
chr3 (90-305)||(8002170-8002384)
chr3 (90-305)||(8217244-8217456)
chr3 (90-305)||(8283905-8284119)
chr3 (90-305)||(17971300-17971511)
chr3 (90-305)||(20571282-20571493)
chr3 (90-305)||(28110392-28110604)
chr3 (90-305)||(31030674-31030886)
chr3 (90-305)||(35886376-35886588)
chr3 (90-305)||(22865282-22865498)
chr3 (90-305)||(22880341-22880557)
chr3 (90-305)||(29659404-29659620)
chr3 (90-305)||(32444761-32444978)
chr3 (90-305)||(5590797-5591007)
chr3 (90-305)||(10648683-10648895)
chr3 (90-305)||(18056872-18057084)
chr3 (90-305)||(18336240-18336452)
chr3 (90-305)||(20071650-20071859)
chr3 (90-305)||(21680313-21680525)
chr3 (90-305)||(22382015-22382228)
chr3 (90-305)||(4422525-4422743)
chr3 (90-305)||(10401754-10401973)
chr3 (90-305)||(32296238-32296453)
chr3 (90-305)||(6207514-6207724)
chr3 (90-305)||(6537179-6537391)
chr3 (90-305)||(11104798-11105009)
chr3 (90-305)||(17979389-17979599)
chr3 (90-305)||(18286790-18287003)
chr3 (90-305)||(18302091-18302304)
chr3 (90-305)||(28344786-28344995)
chr3 (90-305)||(4727240-4727457)
chr3 (94-305)||(4791074-4791285)
chr3 (156-305)||(24333773-24333922)
chr3 (156-305)||(28026891-28027040)
chr3 (90-305)||(15735531-15735744)
chr3 (156-305)||(7078816-7078965)
chr3 (163-308)||(11922890-11923035)
chr3 (163-308)||(22962036-22962181)
chr3 (163-308)||(6573937-6574084)
chr3 (163-308)||(7086577-7086721)
chr3 (163-308)||(27561342-27561489)
chr3 (158-244)||(17931137-17931223)
chr3 (163-261)||(37258241-37258340)
chr3 (163-291)||(46382934-46383064)
chr3 (158-244)||(25268912-25268999)
chr3 (163-291)||(15707073-15707203)
chr3 (163-244)||(8609867-8609948)
chr3 (163-306)||(18904732-18904877)
chr3 (165-241)||(4453051-4453127)
chr3 (163-308)||(4452358-4452505)
chr3 (165-308)||(6960964-6961110)
chr3 (158-244)||(10717369-10717456)
chr3 (158-241)||(30091454-30091537)
chr3 (163-241)||(5603083-5603161)
chr3 (163-291)||(5948332-5948462)
chr3 (163-241)||(8218048-8218126)
chr3 (163-241)||(10402560-10402638)
chr3 (163-241)||(22864618-22864696)
chr3 (163-241)||(22879677-22879755)
chr3 (90-144)||(28027062-28027115)
chr3 (163-241)||(28027701-28027779)
chr3 (163-241)||(28345582-28345660)
chr3 (163-241)||(31958225-31958303)
chr3 (163-244)||(71805-71886)
chr3 (163-204)||(4340380-4340421)
chr3 (163-204)||(4690160-4690201)
chr3 (163-204)||(5473502-5473543)
chr3 (163-204)||(5590061-5590102)
chr3 (163-204)||(5603017-5603058)
chr3 (163-204)||(5658646-5658687)
chr3 (163-204)||(5717584-5717625)
chr3 (163-204)||(5728494-5728535)
chr3 (163-204)||(5763833-5763874)
chr3 (163-204)||(6208409-6208450)
chr3 (163-204)||(7079742-7079783)
chr3 (163-204)||(8218151-8218192)
chr3 (163-204)||(10402663-10402704)
chr3 (163-204)||(11104066-11104107)
chr3 (165-291)||(15581640-15581768)
chr3 (163-204)||(15734817-15734858)
chr3 (163-204)||(15886445-15886486)
chr3 (163-204)||(16422699-16422740)
chr3 (163-204)||(16618207-16618248)
chr3 (163-204)||(17970570-17970611)
chr3 (163-204)||(17978652-17978693)
chr3 (163-244)||(18231602-18231683)
chr3 (163-204)||(18231708-18231749)
chr3 (163-204)||(18249252-18249293)
chr3 (163-244)||(18286125-18286206)
chr3 (163-244)||(18301426-18301507)
chr3 (163-204)||(18337138-18337179)
chr3 (163-204)||(20570552-20570593)
chr3 (163-204)||(21681215-21681256)
chr3 (163-204)||(22864552-22864593)
chr3 (163-204)||(22879611-22879652)
chr3 (163-204)||(24334690-24334731)
chr3 (163-204)||(28027804-28027845)
chr3 (163-204)||(29142458-29142499)
chr3 (163-204)||(29658672-29658713)
chr3 (163-204)||(31958159-31958200)
chr3 (163-204)||(35887275-35887316)
chr3 (163-204)||(47029969-47030010)
chr3 (163-204)||(48472446-48472487)
chr3 (156-244)||(3240297-3240385)
chr3 (90-145)||(7078994-7079048)
chr3 (165-244)||(15532445-15532524)
chr3 (163-291)||(15921089-15921219)
chr3 (158-241)||(23283719-23283802)
chr3 (162-244)||(3681389-3681471)
chr3 (163-241)||(4340446-4340524)
chr3 (163-241)||(4630196-4630274)
chr3 (163-241)||(5020124-5020202)
chr3 (163-241)||(5473399-5473477)
chr3 (163-241)||(6208309-6208387)
chr3 (163-241)||(8283228-8283306)
chr3 (163-241)||(10649483-10649561)
chr3 (163-241)||(18249149-18249227)
chr3 (163-241)||(21681112-21681190)
chr3 (163-241)||(22381351-22381429)
chr3 (163-241)||(24334587-24334665)
chr3 (163-241)||(29142524-29142602)
chr3 (163-241)||(29658738-29658816)
chr3 (162-244)||(30017945-30018027)
chr3 (163-241)||(48472343-48472421)
chr3 (163-241)||(51788433-51788511)
chr3 (163-244)||(3408681-3408762)
chr3 (163-204)||(4423433-4423474)
chr3 (163-204)||(4630299-4630340)
chr3 (163-204)||(4728140-4728181)
chr3 (163-204)||(4790337-4790378)
chr3 (163-204)||(5020227-5020268)
chr3 (163-204)||(8283162-8283203)
chr3 (163-204)||(10649586-10649627)
chr3 (165-245)||(15707801-15707884)
chr3 (223-308)||(17437928-17438012)
chr3 (163-204)||(18286059-18286100)
chr3 (163-204)||(18301360-18301401)
chr3 (163-204)||(20072550-20072591)
chr3 (163-204)||(22381285-22381326)
chr3 (163-204)||(28109655-28109696)
chr3 (163-204)||(28345685-28345726)
chr3 (163-204)||(31029948-31029989)
chr3 (163-200)||(32297149-32297186)
chr3 (163-204)||(32445664-32445705)
chr3 (163-204)||(51788536-51788577)
chr3 (158-241)||(72530-72614)
chr3 (163-203)||(6536447-6536487)
chr3 (165-205)||(15580893-15580933)
chr3 (177-260)||(20445746-20445830)
chr3 (165-244)||(15624539-15624618)
chr3 (90-145)||(24333943-24333997)
chr3 (158-244)||(41003686-41003773)
chr3 (158-244)||(41012467-41012554)
chr3 (163-241)||(4423330-4423408)
chr3 (163-241)||(4728040-4728118)
chr3 (163-241)||(4790403-4790481)
chr3 (163-241)||(5590127-5590205)
chr3 (163-241)||(5717481-5717559)
chr3 (163-241)||(5728391-5728469)
chr3 (163-241)||(5763899-5763977)
chr3 (163-241)||(6536513-6536591)
chr3 (163-241)||(7079639-7079717)
chr3 (163-241)||(11104132-11104210)
chr3 (163-241)||(15886511-15886589)
chr3 (163-241)||(17970636-17970714)
chr3 (163-241)||(17978718-17978796)
chr3 (163-201)||(18057781-18057819)
chr3 (163-241)||(18337034-18337112)
chr3 (163-241)||(20072447-20072525)
chr3 (163-233)||(23284455-23284525)
chr3 (163-241)||(31030014-31030092)
chr3 (163-241)||(32445561-32445639)
chr3 (163-241)||(47029866-47029944)
chr3 (157-206)||(5947566-5947615)
chr3 (157-206)||(6200087-6200136)
chr3 (158-244)||(8200259-8200347)
chr3 (157-206)||(8810171-8810220)
chr3 (165-206)||(10717305-10717346)
chr3 (163-228)||(12475407-12475472)
chr3 (165-206)||(14661917-14661958)
chr3 (165-206)||(25269022-25269063)
chr3 (165-241)||(27560673-27560752)
chr3 (163-228)||(30092174-30092239)
chr3 (163-240)||(32297043-32297120)
chr3 (157-206)||(46383790-46383839)
chr3 (157-206)||(46395056-46395105)
chr3 (165-205)||(7085888-7085928)
chr3 (165-241)||(18904132-18904207)
chr3 (158-205)||(3682130-3682177)
chr3 (158-205)||(5947631-5947678)
chr3 (158-205)||(6200022-6200069)
chr3 (158-205)||(8622035-8622082)
chr3 (158-205)||(13107374-13107421)
chr3 (165-244)||(13108106-13108185)
chr3 (158-205)||(15531757-15531804)
chr3 (158-205)||(15580953-15581000)
chr3 (158-205)||(15921850-15921897)
chr3 (158-201)||(22962784-22962827)
chr3 (158-205)||(30018689-30018736)
chr3 (158-205)||(46383727-46383774)
chr3 (163-241)||(4690057-4690135)
chr3 (163-241)||(5658543-5658621)
chr3 (158-200)||(11922203-11922245)
chr3 (163-241)||(15734883-15734961)
chr3 (163-241)||(16422596-16422674)
chr3 (163-241)||(28109721-28109799)
chr3 (163-241)||(35887172-35887250)
chr3 (165-206)||(72641-72682)
chr3 (156-193)||(266301-266338)
chr3 (163-200)||(7085960-7085997)
chr3 (165-206)||(8622098-8622139)
chr3 (165-206)||(12573655-12573696)
chr3 (165-206)||(13550119-13550160)
chr3 (165-206)||(15531697-15531738)
chr3 (165-206)||(21613643-21613684)
chr3 (165-206)||(37257511-37257552)
chr3 (165-206)||(41003794-41003835)
chr3 (165-206)||(41012575-41012616)
chr3 (165-205)||(8810108-8810148)
chr3 (163-227)||(12553910-12553974)
chr3 (156-204)||(15679776-15679824)
chr3 (165-205)||(15921916-15921956)
[»] chr1 (56 HSPs)
chr1 (90-308)||(16202426-16202644)
chr1 (90-305)||(3646794-3647009)
chr1 (90-308)||(20334809-20335026)
chr1 (90-305)||(10968316-10968528)
chr1 (90-305)||(41787704-41787917)
chr1 (90-305)||(51643869-51644083)
chr1 (90-308)||(20466428-20466642)
chr1 (90-305)||(28590732-28590946)
chr1 (90-305)||(28155388-28155597)
chr1 (156-305)||(10950728-10950877)
chr1 (90-305)||(21892141-21892354)
chr1 (163-258)||(22491718-22491814)
chr1 (163-308)||(13456400-13456547)
chr1 (158-244)||(13469057-13469144)
chr1 (163-291)||(5626485-5626615)
chr1 (165-241)||(13457105-13457181)
chr1 (158-244)||(31557456-31557543)
chr1 (163-204)||(3647701-3647742)
chr1 (163-204)||(10951646-10951687)
chr1 (163-204)||(16201696-16201737)
chr1 (163-204)||(20334076-20334117)
chr1 (163-204)||(20467340-20467381)
chr1 (163-204)||(28591635-28591676)
chr1 (163-204)||(41786970-41787011)
chr1 (163-204)||(51644776-51644817)
chr1 (90-145)||(10950900-10950954)
chr1 (158-228)||(2337741-2337811)
chr1 (163-241)||(28156179-28156257)
chr1 (163-241)||(41787036-41787114)
chr1 (163-244)||(10969114-10969195)
chr1 (163-204)||(28156282-28156323)
chr1 (158-244)||(31545362-31545449)
chr1 (165-244)||(35073259-35073338)
chr1 (163-241)||(3647598-3647676)
chr1 (163-241)||(10951543-10951621)
chr1 (163-201)||(21891419-21891457)
chr1 (163-241)||(28591532-28591610)
chr1 (163-241)||(51644673-51644751)
chr1 (163-244)||(2338463-2338544)
chr1 (165-241)||(2389947-2390026)
chr1 (157-206)||(5625727-5625776)
chr1 (163-204)||(10969220-10969261)
chr1 (165-206)||(31557566-31557607)
chr1 (158-205)||(5625793-5625840)
chr1 (158-205)||(6199407-6199454)
chr1 (177-260)||(9297219-9297302)
chr1 (163-205)||(14815457-14815499)
chr1 (163-241)||(20334142-20334220)
chr1 (163-241)||(20467237-20467315)
chr1 (163-244)||(1959530-1959611)
chr1 (165-206)||(2337679-2337720)
chr1 (157-206)||(14815384-14815433)
chr1 (163-228)||(19372899-19372964)
chr1 (165-206)||(31545470-31545511)
chr1 (165-206)||(35074070-35074111)
chr1 (165-205)||(21454647-21454687)
[»] chr7 (159 HSPs)
chr7 (90-305)||(2104440-2104655)
chr7 (90-305)||(26664192-26664406)
chr7 (90-305)||(26679384-26679598)
chr7 (90-305)||(5141614-5141832)
chr7 (90-305)||(24586814-24587026)
chr7 (90-308)||(16046960-16047175)
chr7 (90-308)||(16512713-16512925)
chr7 (90-305)||(2778900-2779110)
chr7 (90-305)||(4205035-4205247)
chr7 (90-305)||(11446533-11446746)
chr7 (90-305)||(26269368-26269578)
chr7 (90-305)||(45392866-45393076)
chr7 (90-308)||(16444282-16444501)
chr7 (90-305)||(4139526-4139738)
chr7 (90-305)||(5164029-5164242)
chr7 (90-305)||(11419058-11419271)
chr7 (90-305)||(26314127-26314340)
chr7 (90-305)||(26518438-26518651)
chr7 (90-305)||(31084902-31085114)
chr7 (90-305)||(31558672-31558882)
chr7 (90-305)||(39207418-39207631)
chr7 (90-305)||(26532149-26532365)
chr7 (112-308)||(10847263-10847453)
chr7 (90-305)||(2160220-2160429)
chr7 (90-305)||(16732809-16733018)
chr7 (90-305)||(16745800-16746009)
chr7 (90-305)||(26440903-26441111)
chr7 (90-305)||(26509976-26510188)
chr7 (91-305)||(5153730-5153941)
chr7 (90-305)||(31129553-31129763)
chr7 (156-305)||(3450952-3451101)
chr7 (90-305)||(45736953-45737161)
chr7 (211-305)||(10911267-10911361)
chr7 (163-308)||(15195702-15195847)
chr7 (163-308)||(2559154-2559299)
chr7 (163-308)||(29092135-29092280)
chr7 (163-308)||(16125215-16125360)
chr7 (163-308)||(16240035-16240180)
chr7 (163-308)||(1890947-1891094)
chr7 (163-261)||(9471981-9472080)
chr7 (90-195)||(10911199-10911299)
chr7 (165-241)||(1890265-1890341)
chr7 (158-244)||(27971365-27971452)
chr7 (158-244)||(16267904-16267990)
chr7 (158-244)||(5204232-5204319)
chr7 (158-244)||(13836699-13836786)
chr7 (163-249)||(16390806-16390893)
chr7 (163-241)||(3451765-3451843)
chr7 (163-241)||(11418392-11418470)
chr7 (163-291)||(30367318-30367448)
chr7 (163-241)||(39206753-39206831)
chr7 (163-204)||(2161121-2161162)
chr7 (163-204)||(2779795-2779836)
chr7 (163-204)||(5154632-5154673)
chr7 (163-204)||(5164934-5164975)
chr7 (163-204)||(10848134-10848175)
chr7 (163-204)||(10910473-10910514)
chr7 (163-204)||(11418326-11418367)
chr7 (163-204)||(16511987-16512028)
chr7 (163-204)||(24586082-24586123)
chr7 (163-244)||(24586148-24586229)
chr7 (163-204)||(26268632-26268673)
chr7 (163-204)||(26441800-26441841)
chr7 (163-204)||(26596219-26596260)
chr7 (163-204)||(26663459-26663500)
chr7 (163-204)||(26678651-26678692)
chr7 (163-204)||(31557941-31557982)
chr7 (163-204)||(39206687-39206728)
chr7 (164-204)||(4138793-4138833)
chr7 (220-308)||(13482633-13482724)
chr7 (158-244)||(564273-564360)
chr7 (90-145)||(3451122-3451176)
chr7 (158-244)||(27439567-27439654)
chr7 (163-241)||(16745133-16745211)
chr7 (163-201)||(22148441-22148479)
chr7 (163-201)||(22152668-22152706)
chr7 (163-201)||(22208583-22208621)
chr7 (163-241)||(26519237-26519315)
chr7 (163-241)||(31130345-31130423)
chr7 (163-241)||(31558007-31558085)
chr7 (163-241)||(45737749-45737827)
chr7 (163-204)||(5140881-5140922)
chr7 (163-204)||(11447437-11447478)
chr7 (165-206)||(12589347-12589388)
chr7 (163-200)||(16047866-16047903)
chr7 (163-244)||(16268608-16268689)
chr7 (163-204)||(16443550-16443591)
chr7 (163-204)||(26313396-26313437)
chr7 (163-204)||(26519340-26519381)
chr7 (163-244)||(31084235-31084316)
chr7 (163-204)||(31130448-31130489)
chr7 (163-204)||(45393768-45393809)
chr7 (163-204)||(45737852-45737893)
chr7 (177-260)||(795912-795996)
chr7 (163-203)||(4205939-4205979)
chr7 (177-260)||(16284768-16284852)
chr7 (177-244)||(1956304-1956371)
chr7 (158-241)||(9472649-9472732)
chr7 (178-241)||(11447334-11447397)
chr7 (158-201)||(16124570-16124613)
chr7 (163-206)||(26509242-26509285)
chr7 (158-201)||(29092889-29092932)
chr7 (165-244)||(34135471-34135550)
chr7 (158-244)||(38409036-38409123)
chr7 (162-244)||(3426982-3427064)
chr7 (163-241)||(4205835-4205913)
chr7 (163-241)||(5140947-5141025)
chr7 (163-241)||(5154529-5154607)
chr7 (163-241)||(10848031-10848109)
chr7 (163-241)||(10910539-10910617)
chr7 (156-206)||(13836811-13836861)
chr7 (163-241)||(26268698-26268776)
chr7 (163-241)||(26313462-26313540)
chr7 (163-241)||(26663525-26663603)
chr7 (163-241)||(26678717-26678795)
chr7 (163-241)||(45393665-45393743)
chr7 (165-206)||(564209-564250)
chr7 (165-206)||(4942935-4942976)
chr7 (165-206)||(5204168-5204209)
chr7 (157-206)||(8816090-8816139)
chr7 (157-206)||(9472747-9472796)
chr7 (157-206)||(16390073-16390122)
chr7 (165-206)||(16482197-16482238)
chr7 (157-206)||(23881145-23881194)
chr7 (165-206)||(27971301-27971342)
chr7 (165-206)||(29027761-29027802)
chr7 (163-204)||(31084169-31084210)
chr7 (165-206)||(38409146-38409187)
chr7 (157-206)||(42632819-42632868)
chr7 (157-205)||(30366618-30366666)
chr7 (165-204)||(563195-563234)
chr7 (158-205)||(844181-844228)
chr7 (158-205)||(851357-851404)
chr7 (158-205)||(1209361-1209408)
chr7 (158-205)||(3426271-3426318)
chr7 (158-244)||(4942998-4943085)
chr7 (158-205)||(8816028-8816075)
chr7 (165-204)||(16240846-16240885)
chr7 (158-205)||(16390140-16390187)
chr7 (178-241)||(16443631-16443694)
chr7 (182-241)||(22152561-22152620)
chr7 (182-241)||(22208476-22208535)
chr7 (158-205)||(42632885-42632932)
chr7 (163-241)||(2161018-2161096)
chr7 (158-204)||(2559903-2559949)
chr7 (163-241)||(2779692-2779770)
chr7 (163-241)||(4138858-4138936)
chr7 (163-241)||(5164830-5164908)
chr7 (163-217)||(12588557-12588611)
chr7 (163-241)||(16047759-16047837)
chr7 (158-200)||(16240772-16240814)
chr7 (165-203)||(16267844-16267882)
chr7 (163-241)||(16512053-16512131)
chr7 (167-204)||(16745070-16745108)
chr7 (163-241)||(26596116-26596194)
chr7 (164-201)||(563260-563297)
chr7 (163-204)||(27970372-27970413)
chr7 (158-244)||(29027650-29027738)
chr7 (165-205)||(23881217-23881257)
[»] chr8 (89 HSPs)
chr8 (90-305)||(19202719-19202930)
chr8 (90-308)||(15773220-15773435)
chr8 (90-305)||(19680095-19680309)
chr8 (90-305)||(19693747-19693956)
chr8 (90-305)||(27603261-27603473)
chr8 (90-305)||(28356308-28356520)
chr8 (90-305)||(33248018-33248227)
chr8 (90-308)||(19655699-19655911)
chr8 (90-305)||(9360273-9360483)
chr8 (90-305)||(12087079-12087291)
chr8 (90-308)||(16259866-16260084)
chr8 (90-308)||(22138553-22138768)
chr8 (90-305)||(18715132-18715343)
chr8 (90-305)||(21342526-21342739)
chr8 (90-305)||(29834973-29835184)
chr8 (90-305)||(31484227-31484439)
chr8 (90-305)||(18796352-18796567)
chr8 (90-305)||(2131617-2131828)
chr8 (90-305)||(14568807-14569018)
chr8 (90-305)||(33264382-33264592)
chr8 (90-305)||(44566632-44566842)
chr8 (90-305)||(19911519-19911730)
chr8 (90-305)||(31360177-31360389)
chr8 (90-308)||(22075284-22075496)
chr8 (163-308)||(14214660-14214805)
chr8 (163-308)||(22414559-22414704)
chr8 (185-305)||(16288601-16288721)
chr8 (158-249)||(19847523-19847615)
chr8 (163-308)||(16770944-16771091)
chr8 (163-308)||(19846784-19846933)
chr8 (165-241)||(16771686-16771762)
chr8 (163-244)||(28355639-28355720)
chr8 (165-241)||(25794054-25794130)
chr8 (163-206)||(31483493-31483536)
chr8 (163-241)||(31483559-31483637)
chr8 (163-241)||(33265172-33265250)
chr8 (163-204)||(9361159-9361200)
chr8 (163-204)||(12086346-12086387)
chr8 (163-204)||(19654968-19655009)
chr8 (163-204)||(19694643-19694684)
chr8 (163-204)||(22074552-22074593)
chr8 (163-204)||(22139439-22139480)
chr8 (163-204)||(27602537-27602578)
chr8 (163-204)||(28355573-28355614)
chr8 (163-204)||(33248917-33248958)
chr8 (163-204)||(33265275-33265316)
chr8 (158-244)||(17677678-17677765)
chr8 (158-241)||(22158751-22158834)
chr8 (162-241)||(29835771-29835850)
chr8 (158-244)||(39840292-39840379)
chr8 (163-241)||(18715931-18716009)
chr8 (163-201)||(18797262-18797300)
chr8 (163-241)||(21341859-21341937)
chr8 (163-241)||(31360977-31361055)
chr8 (167-204)||(2130894-2130931)
chr8 (163-204)||(14569707-14569748)
chr8 (163-204)||(15774126-15774167)
chr8 (163-204)||(18716034-18716075)
chr8 (163-204)||(19680999-19681040)
chr8 (163-204)||(19910785-19910826)
chr8 (163-204)||(21341793-21341834)
chr8 (165-206)||(22090985-22091026)
chr8 (163-204)||(29835874-29835915)
chr8 (163-204)||(31361080-31361121)
chr8 (163-204)||(44567535-44567576)
chr8 (163-241)||(12086412-12086490)
chr8 (163-241)||(15774023-15774101)
chr8 (163-241)||(19202064-19202142)
chr8 (163-241)||(19655034-19655112)
chr8 (163-241)||(19680896-19680974)
chr8 (163-241)||(22139336-22139414)
chr8 (163-241)||(27602603-27602681)
chr8 (156-206)||(39840219-39840269)
chr8 (163-241)||(44567432-44567510)
chr8 (163-196)||(16260472-16260505)
chr8 (165-206)||(17677613-17677654)
chr8 (165-202)||(19202000-19202037)
chr8 (163-244)||(32003888-32003969)
chr8 (163-244)||(33248811-33248892)
chr8 (158-241)||(21477810-21477894)
chr8 (165-204)||(19847637-19847676)
chr8 (178-241)||(22074633-22074696)
chr8 (165-244)||(22159456-22159535)
chr8 (158-200)||(14215407-14215449)
chr8 (163-241)||(18797156-18797234)
chr8 (163-241)||(19694540-19694618)
chr8 (163-241)||(19910851-19910929)
chr8 (163-205)||(20731824-20731866)
chr8 (165-201)||(22415411-22415447)
[»] chr2 (143 HSPs)
chr2 (90-305)||(13930929-13931143)
chr2 (90-305)||(3788141-3788353)
chr2 (90-305)||(12661185-12661398)
chr2 (90-305)||(20843561-20843772)
chr2 (90-305)||(34269303-34269516)
chr2 (90-305)||(34296802-34297016)
chr2 (90-305)||(39895717-39895927)
chr2 (90-308)||(21697557-21697769)
chr2 (90-305)||(255035-255249)
chr2 (90-305)||(9344370-9344582)
chr2 (90-305)||(27428829-27429037)
chr2 (90-305)||(32055451-32055662)
chr2 (90-305)||(37383325-37383536)
chr2 (90-305)||(37931017-37931231)
chr2 (90-308)||(19450810-19451022)
chr2 (90-305)||(34160492-34160703)
chr2 (90-305)||(22922528-22922744)
chr2 (90-305)||(37680276-37680491)
chr2 (90-305)||(37695541-37695756)
chr2 (90-305)||(11629567-11629780)
chr2 (90-305)||(12592456-12592669)
chr2 (90-305)||(16167128-16167337)
chr2 (90-305)||(27122172-27122384)
chr2 (90-305)||(27781882-27782091)
chr2 (90-305)||(27821639-27821848)
chr2 (90-305)||(31887876-31888087)
chr2 (90-305)||(34867332-34867542)
chr2 (90-305)||(39046205-39046415)
chr2 (90-305)||(21671556-21671771)
chr2 (90-305)||(12710984-12711197)
chr2 (90-305)||(27809351-27809560)
chr2 (90-305)||(28887927-28888138)
chr2 (90-305)||(31881934-31882146)
chr2 (90-302)||(16823723-16823931)
chr2 (90-302)||(16897549-16897757)
chr2 (90-305)||(23122956-23123165)
chr2 (90-305)||(37946249-37946458)
chr2 (90-305)||(40239156-40239368)
chr2 (156-305)||(19410948-19411097)
chr2 (90-272)||(27396001-27396182)
chr2 (163-308)||(42396156-42396301)
chr2 (163-308)||(34703697-34703842)
chr2 (163-262)||(34531927-34532027)
chr2 (163-261)||(22952060-22952159)
chr2 (163-308)||(26721752-26721899)
chr2 (163-244)||(13930261-13930342)
chr2 (163-244)||(39045537-39045618)
chr2 (165-241)||(26721081-26721157)
chr2 (158-244)||(3761100-3761187)
chr2 (165-241)||(34531245-34531321)
chr2 (158-244)||(42569227-42569314)
chr2 (163-241)||(22921860-22921938)
chr2 (163-204)||(254303-254344)
chr2 (163-204)||(9343638-9343679)
chr2 (163-204)||(12593364-12593405)
chr2 (163-204)||(12662041-12662082)
chr2 (163-204)||(12710252-12710293)
chr2 (163-204)||(16168028-16168069)
chr2 (163-204)||(16822988-16823029)
chr2 (163-244)||(16823054-16823135)
chr2 (163-244)||(16898345-16898426)
chr2 (163-204)||(16898451-16898492)
chr2 (163-204)||(19450069-19450110)
chr2 (163-204)||(20844464-20844505)
chr2 (163-204)||(22921794-22921835)
chr2 (163-204)||(23122227-23122268)
chr2 (163-204)||(27396886-27396927)
chr2 (163-204)||(27782780-27782821)
chr2 (163-204)||(27810253-27810294)
chr2 (163-204)||(31868437-31868478)
chr2 (163-204)||(32056303-32056344)
chr2 (163-204)||(34161396-34161437)
chr2 (163-204)||(34868184-34868225)
chr2 (163-204)||(37945516-37945557)
chr2 (163-204)||(40240058-40240099)
chr2 (158-244)||(21854655-21854742)
chr2 (165-204)||(28888804-28888843)
chr2 (158-244)||(35144016-35144103)
chr2 (163-241)||(11628902-11628980)
chr2 (163-241)||(12593261-12593339)
chr2 (163-241)||(16167925-16168003)
chr2 (163-241)||(19410201-19410279)
chr2 (90-136)||(19410870-19410916)
chr2 (163-241)||(23122293-23122371)
chr2 (163-244)||(24290500-24290582)
chr2 (163-241)||(27122970-27123048)
chr2 (163-241)||(37384124-37384202)
chr2 (163-241)||(37931826-37931904)
chr2 (163-241)||(40239955-40240033)
chr2 (157-206)||(12387033-12387082)
chr2 (163-204)||(19410135-19410176)
chr2 (163-204)||(23117347-23117388)
chr2 (163-204)||(27123073-27123114)
chr2 (163-204)||(27428104-27428145)
chr2 (163-204)||(31882836-31882877)
chr2 (167-204)||(34268581-34268618)
chr2 (163-204)||(34297699-34297740)
chr2 (163-204)||(37384227-37384268)
chr2 (163-204)||(37679542-37679583)
chr2 (163-204)||(37694807-37694848)
chr2 (163-204)||(37931929-37931970)
chr2 (163-204)||(39896618-39896659)
chr2 (164-204)||(21670821-21670861)
chr2 (158-244)||(16278892-16278979)
chr2 (166-241)||(31882733-31882808)
chr2 (163-241)||(254369-254447)
chr2 (163-241)||(12710318-12710396)
chr2 (163-241)||(19450135-19450213)
chr2 (163-241)||(23117243-23117321)
chr2 (156-206)||(25500111-25500161)
chr2 (163-241)||(27428170-27428248)
chr2 (163-241)||(27810150-27810228)
chr2 (163-241)||(28888701-28888779)
chr2 (163-241)||(34161293-34161371)
chr2 (163-241)||(34268643-34268721)
chr2 (163-241)||(37945582-37945660)
chr2 (163-241)||(39896515-39896593)
chr2 (165-206)||(3761036-3761077)
chr2 (163-204)||(3788995-3789036)
chr2 (163-204)||(11628836-11628877)
chr2 (165-206)||(15947690-15947731)
chr2 (163-204)||(21696837-21696878)
chr2 (165-206)||(42569166-42569207)
chr2 (163-227)||(20277448-20277512)
chr2 (163-239)||(21670886-21670962)
chr2 (177-260)||(21753149-21753233)
chr2 (163-239)||(37679608-37679684)
chr2 (163-239)||(37694873-37694949)
chr2 (158-205)||(12386908-12386955)
chr2 (158-205)||(12386971-12387018)
chr2 (158-244)||(15947752-15947838)
chr2 (158-244)||(25499999-25500086)
chr2 (158-201)||(42396890-42396933)
chr2 (158-200)||(3760078-3760120)
chr2 (163-241)||(20844361-20844439)
chr2 (163-241)||(21696903-21696981)
chr2 (163-233)||(24694112-24694182)
chr2 (163-241)||(27396783-27396861)
chr2 (165-206)||(16279002-16279043)
chr2 (165-206)||(20616246-20616287)
chr2 (165-206)||(24290606-24290647)
chr2 (165-233)||(20615361-20615429)
chr2 (177-260)||(21758110-21758193)
[»] chr4 (112 HSPs)
chr4 (90-308)||(1905910-1906125)
chr4 (90-305)||(30759422-30759636)
chr4 (90-305)||(33668194-33668408)
chr4 (90-308)||(15277025-15277237)
chr4 (90-305)||(5700197-5700411)
chr4 (90-305)||(20332816-20333028)
chr4 (90-305)||(40100030-40100244)
chr4 (90-305)||(54839053-54839264)
chr4 (90-305)||(6575520-6575734)
chr4 (90-305)||(14104205-14104416)
chr4 (90-305)||(18795010-18795221)
chr4 (90-305)||(21975363-21975573)
chr4 (90-305)||(24586755-24586968)
chr4 (90-305)||(36338911-36339124)
chr4 (90-305)||(39856299-39856509)
chr4 (90-305)||(17018708-17018924)
chr4 (90-305)||(14753886-14754099)
chr4 (90-305)||(18311572-18311785)
chr4 (90-308)||(15233475-15233689)
chr4 (90-305)||(5011537-5011749)
chr4 (90-305)||(14670675-14670888)
chr4 (90-305)||(24118324-24118534)
chr4 (90-302)||(31120907-31121116)
chr4 (90-305)||(27157710-27157924)
chr4 (90-305)||(34183355-34183565)
chr4 (90-308)||(15380631-15380853)
chr4 (163-308)||(19769974-19770119)
chr4 (163-308)||(14723288-14723433)
chr4 (158-244)||(33184035-33184121)
chr4 (165-244)||(1878924-1879004)
chr4 (163-262)||(1879594-1879694)
chr4 (165-308)||(22144057-22144203)
chr4 (165-244)||(26215272-26215352)
chr4 (158-241)||(55791643-55791726)
chr4 (163-260)||(12517536-12517633)
chr4 (158-244)||(8097806-8097893)
chr4 (158-241)||(20558776-20558859)
chr4 (163-241)||(39857095-39857173)
chr4 (163-244)||(3384854-3384935)
chr4 (163-204)||(6576418-6576459)
chr4 (163-204)||(14105105-14105146)
chr4 (163-204)||(14671576-14671617)
chr4 (163-204)||(14753155-14753196)
chr4 (163-244)||(14753221-14753302)
chr4 (163-204)||(15234383-15234424)
chr4 (163-204)||(15276290-15276331)
chr4 (163-204)||(15379899-15379940)
chr4 (163-204)||(17019612-17019653)
chr4 (163-204)||(18794281-18794322)
chr4 (163-204)||(21976267-21976308)
chr4 (163-204)||(24119225-24119266)
chr4 (163-204)||(30760325-30760366)
chr4 (163-204)||(31120171-31120212)
chr4 (163-244)||(31120237-31120318)
chr4 (163-204)||(33667464-33667505)
chr4 (163-204)||(34182625-34182666)
chr4 (163-204)||(36323977-36324018)
chr4 (163-204)||(36338186-36338227)
chr4 (163-204)||(40099297-40099338)
chr4 (163-204)||(54839954-54839995)
chr4 (163-206)||(1674422-1674465)
chr4 (163-206)||(1906821-1906864)
chr4 (158-228)||(3830507-3830577)
chr4 (163-241)||(5701000-5701078)
chr4 (163-241)||(27157039-27157117)
chr4 (163-241)||(30760222-30760300)
chr4 (163-241)||(33667530-33667608)
chr4 (163-244)||(3361388-3361469)
chr4 (163-204)||(5012441-5012482)
chr4 (163-204)||(5701103-5701144)
chr4 (163-244)||(15895497-15895578)
chr4 (163-244)||(21976161-21976242)
chr4 (163-204)||(27156973-27157014)
chr4 (163-204)||(39857198-39857239)
chr4 (160-260)||(55786813-55786914)
chr4 (158-241)||(9189190-9189274)
chr4 (165-249)||(15570124-15570208)
chr4 (165-249)||(15574252-15574336)
chr4 (178-241)||(17019509-17019572)
chr4 (158-201)||(19770709-19770752)
chr4 (165-244)||(20558059-20558138)
chr4 (163-238)||(36324044-36324119)
chr4 (163-238)||(36338253-36338328)
chr4 (165-244)||(39531596-39531675)
chr4 (178-244)||(5012335-5012401)
chr4 (163-241)||(6576315-6576393)
chr4 (163-241)||(14105002-14105080)
chr4 (163-241)||(14671473-14671551)
chr4 (211-308)||(17296937-17297035)
chr4 (163-241)||(24119122-24119200)
chr4 (163-241)||(34182691-34182769)
chr4 (163-241)||(40099363-40099441)
chr4 (165-206)||(3363588-3363629)
chr4 (165-206)||(8097745-8097786)
chr4 (177-241)||(22709719-22709784)
chr4 (165-205)||(14722583-14722623)
chr4 (163-227)||(16723181-16723245)
chr4 (158-221)||(3363503-3363566)
chr4 (163-206)||(20332084-20332127)
chr4 (163-206)||(24586022-24586065)
chr4 (163-238)||(54839854-54839929)
chr4 (163-221)||(3362108-3362166)
chr4 (163-221)||(3362805-3362863)
chr4 (158-200)||(14722650-14722692)
chr4 (163-221)||(14875020-14875078)
chr4 (163-241)||(15379965-15380043)
chr4 (163-228)||(14923165-14923230)
chr4 (165-206)||(14923248-14923289)
chr4 (165-206)||(15894723-15894764)
chr4 (165-206)||(22709820-22709861)
chr4 (165-206)||(33184142-33184183)
chr4 (165-205)||(12616580-12616620)
[»] scaffold0143 (7 HSPs)
scaffold0143 (90-308)||(32939-33158)
scaffold0143 (211-305)||(9609-9703)
scaffold0143 (90-195)||(9671-9775)
scaffold0143 (163-204)||(33847-33888)
scaffold0143 (164-204)||(10466-10506)
scaffold0143 (163-241)||(10363-10441)
scaffold0143 (163-241)||(33744-33822)
[»] scaffold0288 (1 HSPs)
scaffold0288 (90-305)||(28-238)
[»] scaffold0237 (3 HSPs)
scaffold0237 (90-305)||(9321-9535)
scaffold0237 (163-241)||(8656-8734)
scaffold0237 (163-204)||(8590-8631)
[»] scaffold0089 (3 HSPs)
scaffold0089 (90-305)||(5716-5927)
scaffold0089 (163-204)||(6615-6656)
scaffold0089 (163-241)||(6512-6590)
[»] scaffold0038 (3 HSPs)
scaffold0038 (90-305)||(13598-13810)
scaffold0038 (163-204)||(14502-14543)
scaffold0038 (163-241)||(14399-14477)
[»] scaffold0254 (1 HSPs)
scaffold0254 (90-305)||(18231-18446)
[»] scaffold0418 (3 HSPs)
scaffold0418 (90-305)||(11685-11899)
scaffold0418 (163-204)||(12587-12628)
scaffold0418 (163-241)||(12484-12562)
[»] scaffold0336 (3 HSPs)
scaffold0336 (90-305)||(15220-15430)
scaffold0336 (163-241)||(16025-16103)
scaffold0336 (163-204)||(16128-16169)
[»] scaffold0322 (6 HSPs)
scaffold0322 (90-305)||(1307-1518)
scaffold0322 (90-308)||(11691-11908)
scaffold0322 (163-244)||(2103-2184)
scaffold0322 (163-204)||(2209-2250)
scaffold0322 (163-241)||(12493-12571)
scaffold0322 (163-204)||(12596-12637)
[»] scaffold0159 (6 HSPs)
scaffold0159 (90-305)||(3574-3786)
scaffold0159 (166-305)||(13263-13402)
scaffold0159 (163-204)||(2840-2881)
scaffold0159 (163-204)||(18360-18401)
scaffold0159 (163-241)||(2906-2984)
scaffold0159 (163-241)||(18257-18335)
[»] scaffold0242 (1 HSPs)
scaffold0242 (91-308)||(130-344)
[»] scaffold0144 (2 HSPs)
scaffold0144 (90-305)||(20586-20798)
scaffold0144 (158-242)||(9089-9174)
[»] scaffold0240 (2 HSPs)
scaffold0240 (90-305)||(25295-25506)
scaffold0240 (163-204)||(24615-24656)
[»] scaffold0792 (2 HSPs)
scaffold0792 (90-305)||(5001-5213)
scaffold0792 (163-204)||(4262-4304)
[»] scaffold0415 (1 HSPs)
scaffold0415 (90-305)||(11672-11891)
[»] scaffold0109 (3 HSPs)
scaffold0109 (90-308)||(24762-24977)
scaffold0109 (163-204)||(25674-25715)
scaffold0109 (163-241)||(25571-25649)
[»] scaffold0547 (4 HSPs)
scaffold0547 (211-305)||(10103-10197)
scaffold0547 (90-195)||(10033-10135)
scaffold0547 (163-204)||(9303-9344)
scaffold0547 (163-241)||(9369-9447)
[»] scaffold0404 (3 HSPs)
scaffold0404 (165-308)||(12840-12983)
scaffold0404 (158-200)||(13583-13625)
scaffold0404 (158-200)||(13741-13783)
[»] scaffold0031 (3 HSPs)
scaffold0031 (163-308)||(15879-16028)
scaffold0031 (165-241)||(15201-15277)
scaffold0031 (163-228)||(27715-27780)
[»] scaffold0046 (2 HSPs)
scaffold0046 (163-305)||(51527-51675)
scaffold0046 (158-249)||(52254-52348)
[»] scaffold1837 (2 HSPs)
scaffold1837 (163-308)||(1168-1315)
scaffold1837 (165-241)||(527-607)
[»] scaffold0029 (4 HSPs)
scaffold0029 (163-261)||(31840-31939)
scaffold0029 (165-244)||(89661-89740)
scaffold0029 (163-216)||(8034-8087)
scaffold0029 (165-205)||(90415-90455)
[»] scaffold0160 (2 HSPs)
scaffold0160 (163-308)||(32952-33095)
scaffold0160 (165-233)||(33702-33770)
[»] scaffold0799 (2 HSPs)
scaffold0799 (158-241)||(5226-5309)
scaffold0799 (160-260)||(228-329)
[»] scaffold0257 (2 HSPs)
scaffold0257 (158-244)||(150-237)
scaffold0257 (177-206)||(247-276)
[»] scaffold0044 (2 HSPs)
scaffold0044 (158-244)||(69111-69198)
scaffold0044 (165-206)||(69047-69088)
[»] scaffold0306 (1 HSPs)
scaffold0306 (163-244)||(19302-19383)
[»] scaffold0157 (1 HSPs)
scaffold0157 (163-260)||(3278-3375)
[»] scaffold0114 (2 HSPs)
scaffold0114 (163-244)||(30027-30108)
scaffold0114 (165-205)||(29251-29291)
[»] scaffold1418 (3 HSPs)
scaffold1418 (158-244)||(1400-1487)
scaffold1418 (158-242)||(422-507)
scaffold1418 (165-206)||(1336-1377)
[»] scaffold0605 (2 HSPs)
scaffold0605 (158-244)||(3371-3458)
scaffold0605 (165-206)||(3311-3352)
[»] scaffold0357 (2 HSPs)
scaffold0357 (165-244)||(10460-10539)
scaffold0357 (158-241)||(11160-11243)
[»] scaffold0132 (3 HSPs)
scaffold0132 (158-241)||(28331-28414)
scaffold0132 (163-244)||(27616-27697)
scaffold0132 (163-244)||(32596-32677)
[»] scaffold0015 (1 HSPs)
scaffold0015 (158-244)||(173139-173226)
[»] scaffold0014 (4 HSPs)
scaffold0014 (163-249)||(1603-1689)
scaffold0014 (158-244)||(2333-2419)
scaffold0014 (158-241)||(181803-181886)
scaffold0014 (165-206)||(2437-2478)
[»] scaffold0582 (2 HSPs)
scaffold0582 (163-244)||(3601-3682)
scaffold0582 (158-241)||(2882-2965)
[»] scaffold0019 (3 HSPs)
scaffold0019 (163-204)||(154914-154955)
scaffold0019 (158-241)||(15195-15279)
scaffold0019 (163-244)||(15932-16013)
[»] scaffold0094 (1 HSPs)
scaffold0094 (163-260)||(32738-32837)
[»] scaffold0083 (1 HSPs)
scaffold0083 (165-244)||(20955-21035)
[»] scaffold0451 (1 HSPs)
scaffold0451 (158-244)||(185-272)
[»] scaffold0389 (1 HSPs)
scaffold0389 (158-244)||(5201-5288)
[»] scaffold0068 (2 HSPs)
scaffold0068 (165-244)||(21180-21259)
scaffold0068 (157-206)||(20394-20443)
[»] scaffold0016 (2 HSPs)
scaffold0016 (158-244)||(21010-21097)
scaffold0016 (157-206)||(21114-21163)
[»] scaffold0243 (2 HSPs)
scaffold0243 (163-244)||(18565-18646)
scaffold0243 (165-206)||(19320-19361)
[»] scaffold0093 (2 HSPs)
scaffold0093 (163-204)||(326-367)
scaffold0093 (165-241)||(223-299)
[»] scaffold0320 (1 HSPs)
scaffold0320 (165-244)||(2660-2739)
[»] scaffold0009 (1 HSPs)
scaffold0009 (163-291)||(154976-155101)
[»] scaffold0721 (2 HSPs)
scaffold0721 (177-241)||(5530-5595)
scaffold0721 (165-206)||(5453-5494)
[»] scaffold0441 (1 HSPs)
scaffold0441 (163-244)||(8050-8131)
[»] scaffold0125 (2 HSPs)
scaffold0125 (163-244)||(13332-13413)
scaffold0125 (158-205)||(14065-14112)
[»] scaffold1056 (1 HSPs)
scaffold1056 (165-205)||(1168-1208)
[»] scaffold0932 (1 HSPs)
scaffold0932 (165-241)||(3736-3812)
[»] scaffold1661 (1 HSPs)
scaffold1661 (165-244)||(1171-1250)
[»] scaffold0047 (2 HSPs)
scaffold0047 (158-200)||(79686-79728)
scaffold0047 (165-203)||(79761-79799)
[»] scaffold0183 (1 HSPs)
scaffold0183 (163-228)||(33404-33469)
[»] scaffold0004 (1 HSPs)
scaffold0004 (163-244)||(190609-190690)
[»] scaffold1691 (1 HSPs)
scaffold1691 (165-244)||(1157-1237)
[»] scaffold0327 (1 HSPs)
scaffold0327 (157-205)||(16403-16451)
[»] scaffold0099 (1 HSPs)
scaffold0099 (196-304)||(41173-41292)


Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 182)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 27624048 - 27624264
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
T  27624048 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttttgcctggatcgccctttcgggt 27624145  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27624146 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 27624245  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  27624246 ctatatcagcattcacagg 27624264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 27284701 - 27284917
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  27284701 gagacgctcatttttgcctgagttgcgtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 27284798  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27284799 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 27284898  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  27284899 ctatatcagcattcacagg 27284917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 13518533 - 13518744
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  13518533 gagacgctcatttttgcctgagttgcgaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 13518628  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  13518629 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 13518728  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  13518729 ctatatcagcattcac 13518744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 13293285 - 13293501
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |          | |||||||||||||||||||| ||||||||||||    
T  13293285 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatatttctttttttgtgtcccttatttttgcctggaccgccctttcggg 13293384  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  13293385 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 13293484  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  13293485 actatatcggcattcac 13293501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 4763622 - 4763409
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  4763622 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttcttg-tcccttatttttgcctggaccgccctttcgggt 4763525  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  4763524 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 4763425  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  4763424 ctatatcggcattcac 4763409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 16938365 - 16938577
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  16938365 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 16938461  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  16938462 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 16938561  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  16938562 ctatatcggcattcac 16938577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27013591 - 27013378
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  27013591 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 27013494  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27013493 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27013394  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27013393 ctatatcggcattcac 27013378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 29555416 - 29555204
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  29555416 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 29555320  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  29555319 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 29555220  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  29555219 ctatatcggcattcac 29555204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 4718475 - 4718685
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  4718475 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 4718569  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  4718570 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 4718669  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  4718670 ctatatcggcattcac 4718685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 24869568 - 24869356
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  24869568 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 24869472  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  24869471 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 24869372  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  24869371 ctatatcggcattcac 24869356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 26926628 - 26926416
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  26926628 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 26926532  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  26926531 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 26926432  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26926431 ctatatcggcattcac 26926416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27063339 - 27063129
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  27063339 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 27063245  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27063244 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27063145  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27063144 ctatatcggcattcac 27063129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 28213312 - 28213100
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  28213312 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 28213216  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  28213215 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 28213116  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  28213115 ctatatcggcattcac 28213100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 29507274 - 29507062
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  29507274 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 29507178  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  29507177 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 29507078  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  29507077 ctatatcggcattcac 29507062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 34458846 - 34459056
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  34458846 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 34458940  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  34458941 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 34459040  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  34459041 ctatatcggcattcac 34459056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 28166352 - 28166137
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttc-atatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||  |||||||         | ||||||||||||||||||| ||||||||||||    
T  28166352 gagacgctcattcttgcctgagttgcgtacaatcccagcgagctttttttatatttgtttttttttg-tcccttatttttgcctggaccgccctttcggg 28166254  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  28166253 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 28166154  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  28166153 actatatcggcattcac 28166137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 4778738 - 4778526
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  4778738 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 4778642  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  4778641 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 4778542  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  4778541 ctatatcggcattcac 4778526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 8900039 - 8900253
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  8900039 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 8900137  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  8900138 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcggattttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 8900237  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  8900238 ctatatcggcattcac 8900253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 22929222 - 22929434
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||    
T  22929222 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggt 22929318  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  22929319 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 22929418  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  22929419 ctatatcggcattcac 22929434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 23851667 - 23851879
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||    
T  23851667 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggt 23851763  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  23851764 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 23851863  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  23851864 ctatatcggcattcac 23851879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27200044 - 27199831
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||    
T  27200044 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatatttttttg-tcccttatttttgcctggaccgccctttcgggt 27199947  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27199946 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27199847  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27199846 ctatatcggcattcac 27199831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 27249190 - 27249403
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||    
T  27249190 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatatttttttg-tcccttatttttgcctggaccgccctttcgggt 27249287  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27249288 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27249387  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27249388 ctatatcggcattcac 27249403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 27264454 - 27264664
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| | |||||||||||||||||||||| |||           |||||||||||||||||||| |||||||||||||    
T  27264454 gagacgctcattcttgcctgagttgcatgcaatctcagcgagctttttcattttttttttt-----gtcccttatttttgcctggaccgccctttcgggt 27264548  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27264549 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27264648  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27264649 ctatatcggcattcac 27264664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 29578873 - 29578660
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  29578873 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggt 29578776  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  29578775 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 29578676  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  29578675 ctatatcggcattcac 29578660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 4531146 - 4530931
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||    
T  4531146 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttgttttttttgtcccttatttttgcctggaccgccctttcggg 4531048  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||    
T  4531047 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttg 4530948  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  4530947 actatatcggcattcac 4530931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26110750 - 26110962
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  26110750 gagacactcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 26110846  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  26110847 tctcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 26110946  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26110947 ctatatcggcattcac 26110962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 26791674 - 26791462
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| | |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  26791674 gagacgctcattcttgcctgagttgcctgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 26791578  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||    
T  26791577 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgttgttcttttcatatttctaggcaaagtatttcttga 26791478  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26791477 ctatatcggcattcac 26791462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27030879 - 27030669
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  27030879 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 27030785  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27030784 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcaggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27030685  T
Q  290 ctatatcagcattcac 305  Q
    |||| || ||||||||    
T  27030684 ctatgtcggcattcac 27030669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 27356451 - 27356660
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  27356451 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 27356544  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27356545 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27356644  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27356645 ctatatcggcattcac 27356660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27490991 - 27490779
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           ||||||||||||| |||||| |||||||||||||    
T  27490991 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttacctggaccgccctttcgggt 27490895  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27490894 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27490795  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27490794 ctatatcggcattcac 27490779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 16679997 - 16679786
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||    
T  16679997 gagacgctcattcttgcctgagttgcgcacaatctcagcgagcttttttcatatattttttt-----gtcccttatttttgcctggaccgccctttcggg 16679903  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||    
T  16679902 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttg 16679803  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  16679802 actatatcggcattcac 16679786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27184786 - 27184575
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    |||||||||||||||||||||||||| | ||||||||||||||||||| ||| |||           |||||||||||||||||||| ||||||||||||    
T  27184786 gagacgctcattcttgcctgagttgcatgcaatctcagcgagcttttttcattttttttttt-----gtcccttatttttgcctggaccgccctttcggg 27184692  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  27184691 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 27184592  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  27184591 actatatcggcattcac 27184575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 24300095 - 24300307
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  24300095 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatttttttttt--gtcccttatttttgcctggaccgccctttcgggt 24300191  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  24300192 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcggattttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 24300291  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  24300292 ctatatcggcattcac 24300307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 33370771 - 33370981
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||          |||||||||||| ||||||| |||||||||||||    
T  33370771 gagacgctcattcttgcctgagttgtgtataatctcagcgagctttt-catatttgttttttt---gtcccttatttt-gcctggaccgccctttcgggt 33370865  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  33370866 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 33370965  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  33370966 ctatatcggcattcac 33370981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 14139734 - 14139944
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          ||||||||||||| |||||| |||||||||||||    
T  14139734 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttattttttcctggaccgccctttcgggt 14139828  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  14139829 ttaccatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 14139928  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  14139929 ctatatcggcattcac 14139944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 16755678 - 16755467
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  16755678 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 16755583  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||    
T  16755582 tttcgatccaccgggaggcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatgtttctaggcaaagtatttcttga 16755483  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| || |||||    
T  16755482 ctatatcggcgttcac 16755467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26772968 - 26773177
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||          |||||||||||| ||||||| |||||||||||||    
T  26772968 gagacgctcattcttgcctgagttgtatacaatctcagcgagctttt-catatttgtttttt----gtcccttatttt-gcctggaccgccctttcgggt 26773061  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  26773062 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 26773161  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26773162 ctatatcggcattcac 26773177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 90 - 306
Target Start/End: Complemental strand, 20174407 - 20174192
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| ||||||            |||||||||||||||||||| |||||||||||||    
T  20174407 gagacgctcatttttgcctgagttgcgtacaatctcagcgagctttt-catattcattctgttttagtcccttatttttgcctggaccgccctttcgggt 20174309  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| | ||||| |||||||||||||    
T  20174308 tttcgatccatcgggaagcgcatttttgcctaggccgccctttcggattttcgacctgccacgctgttcttttcatatttttaggcaaagtatttcttga 20174209  T
Q  290 ctatatcagcattcaca 306  Q
     ||||||||||||||||    
T  20174208 atatatcagcattcaca 20174192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 90 - 306
Target Start/End: Original strand, 22161584 - 22161799
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| ||||||            |||||||||||||||||||| |||||||||||||    
T  22161584 gagacgctcatttttgcctgagttgcgtacaatctcagcgagctttt-catattcattctgttttagtcccttatttttgcctggaccgccctttcgggt 22161682  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| | ||||| |||||||||||||    
T  22161683 tttcgatccatcgggaagcgcatttttgcctaggccgccctttcggattttcgacctgccacgctgttcttttcatatttttaggcaaagtatttcttga 22161782  T
Q  290 ctatatcagcattcaca 306  Q
     ||||||||||||||||    
T  22161783 atatatcagcattcaca 22161799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 15406869 - 15407083
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| | ||||| ||||||||||||| ||||             |||||||||||||||||||| |||||||||||||    
T  15406869 gagacgctcattcttgcctgagttgcatgcaatcgcagcgagcttttt-atataatttttttttgtgtcccttatttttgcctggaccgccctttcgggt 15406967  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  15406968 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 15407067  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  15407068 ctatatcggcattcac 15407083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 15418656 - 15418870
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| | ||||| ||||||||||||| ||||             |||||||||||||||||||| |||||||||||||    
T  15418656 gagacgctcattcttgcctgagttgcatgcaatcgcagcgagcttttt-atataatttttttttgtgtcccttatttttgcctggaccgccctttcgggt 15418754  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  15418755 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 15418854  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  15418855 ctatatcggcattcac 15418870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 30552356 - 30552566
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||| |           |||||||||||| ||||||| |||||||||||||    
T  30552356 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatatattttttt---gtcccttatttt-gcctggaccgccctttcgggt 30552450  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  30552451 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 30552550  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  30552551 ctatatcggcattcac 30552566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 161 - 308
Target Start/End: Complemental strand, 27024927 - 27024780
Alignment:
Q  161 ttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27024927 ttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 27024828  T
Q  261 ttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |||| || ||||||| ||||||||||||||||||||||||||||||||    
T  27024827 ttcacatgtctaggcaaagtatttcttgactatatcagcattcacagg 27024780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 156 - 305
Target Start/End: Original strand, 4540175 - 4540324
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4540175 gtcccttatttttgcctggaccgccctttcgggttttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 4540274  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    ||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  4540275 ttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 4540324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 29402191 - 29402264
Alignment:
Q  17 aaaatgaactttcaaagcatataatagaagaaaagtagggatcgtctgcattcacgtatttggaatatcgatgg 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29402191 aaaatgaactttcaaagcatataatagaagaaaagtagggatcgtctgcattcacgtatttggaatatcgatgg 29402264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 18210101 - 18210246
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  18210101 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 18210200  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  18210201 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 18210246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 21363070 - 21363215
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  21363070 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 21363169  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  21363170 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 21363215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 23967052 - 23967197
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  23967052 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 23967151  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  23967152 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 23967197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 165 - 308
Target Start/End: Complemental strand, 18122231 - 18122088
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttttc 263  Q
    ||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  |||||||||||     
T  18122231 ttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttctttt- 18122133  T
Q  264 atatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  18122132 atatatttagacaaagtatttcttgactgcatcagaattcacagg 18122088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 25709720 - 25709573
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||| ||||||||||||||||||||||||  ||||||||||    
T  25709720 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggctgccctttcgggttttcgacctaccgagctgttcttt 25709621  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | |||| ||| | |||||||||||||||  ||||| |||||||||    
T  25709620 tatacatatttagacaaagtatttcttgactgcatcagaattcacagg 25709573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 27547668 - 27547521
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | ||||||||||||||||||||| |||||||  ||||||||||    
T  27547668 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 27547569  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  27547568 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 27547521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 25710345 - 25710269
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||| |||| ||||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  25710345 ttttgcatggaccgccctttcgggttttcaatccaccgggacgctcttttttgcctaagccgccctttcgggttttc 25710269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 27548335 - 27548259
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  27548335 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 27548259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 90 - 145
Target Start/End: Original strand, 4540099 - 4540153
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttg 145  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  4540099 gagacgctcattcttgcctgagttgcgtacaatctcagcgagc-ttttcatatttg 4540153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 16584723 - 16584636
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  16584723 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 16584636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 16610657 - 16610744
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  16610657 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 16610744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 27515821 - 27515738
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||||| |||||| |||| |||||||    
T  27515821 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcctaagccgccttttcaggttttc 27515738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 18752933 - 18753019
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| ||| |||||||||||||  |||| ||||| || |||||||||||| ||||||||| ||||||||||||    
T  18752933 ccctaatttttgcctggaccgcgctttcgggttttcagtccatcgggacgctcatttttgcctaagccgcccttacgggttttcgac 18753019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 158 - 242
Target Start/End: Complemental strand, 16639697 - 16639612
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcg 242  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||    
T  16639697 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcg 16639612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 162 - 206
Target Start/End: Original strand, 27623314 - 27623358
Alignment:
Q  162 tatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  27623314 tatttttgcctggatcgccctttcgggttttcgatccaccgggaa 27623358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 174410 - 174323
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  174410 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 174323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 27053474 - 27053561
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  27053474 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcattttttgcttaagccgccctttcgggttttcgac 27053561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 15648234 - 15648320
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||| |||||| || |||||||||||||  ||||||||||| || |||||||||||| |||||| |||| ||||||||||    
T  15648234 ccctaattttttcctggaccgtcctttcgggtttttaatccaccgggacgctcatttttgcctaagccgccttttcaggttttcgac 15648320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27200710 - 27200632
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||||||||||||||||||||||||||    
T  27200710 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggccgccctttcgggttttc 27200632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 27248523 - 27248601
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||||||||||||||||||||||||||    
T  27248523 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggccgccctttcgggttttc 27248601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27491656 - 27491578
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  27491656 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 27491578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 4539366 - 4539407
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  4539366 atttttgcctggatcgccctttcgggttttcgatccaccggg 4539407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 8899307 - 8899348
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  8899307 atttttgcctggatcgccctttcgggttttcgatccaccggg 8899348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 8899373 - 8899454
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| || ||||||||||||| || || || ||||  || |||||||||||| ||||||||||||||||||||||    
T  8899373 atttttgcctgaattgccctttcgggttgtcaattcagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 8899454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 262
Target Start/End: Original strand, 9133783 - 9133884
Alignment:
Q  163 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  9133783 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 9133882  T
Q  261 tt 262  Q
    ||    
T  9133883 tt 9133884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 14139008 - 14139049
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14139008 atttttgcctggatcgccctttcgggttttcgatccaccggg 14139049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15406141 - 15406182
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15406141 atttttgcctggatcgccctttcgggttttcgatccaccggg 15406182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15417928 - 15417969
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15417928 atttttgcctggatcgccctttcgggttttcgatccaccggg 15417969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 16680729 - 16680688
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16680729 atttttgcctggatcgccctttcgggttttcgatccaccggg 16680688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 16937633 - 16937674
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16937633 atttttgcctggatcgccctttcgggttttcgatccaccggg 16937674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22928488 - 22928529
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22928488 atttttgcctggatcgccctttcgggttttcgatccaccggg 22928529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 24299368 - 24299409
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24299368 atttttgcctggatcgccctttcgggttttcgatccaccggg 24299409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 26110017 - 26110058
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26110017 atttttgcctggatcgccctttcgggttttcgatccaccggg 26110058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 26666266 - 26666307
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26666266 atttttgcctggatcgccctttcgggttttcgatccaccggg 26666307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 26772237 - 26772278
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26772237 atttttgcctggatcgccctttcgggttttcgatccaccggg 26772278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 26927342 - 26927301
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26927342 atttttgcctggatcgccctttcgggttttcgatccaccggg 26927301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27014316 - 27014275
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27014316 atttttgcctggatcgccctttcgggttttcgatccaccggg 27014275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27031610 - 27031569
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27031610 atttttgcctggatcgccctttcgggttttcgatccaccggg 27031569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27064071 - 27064030
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27064071 atttttgcctggatcgccctttcgggttttcgatccaccggg 27064030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 27070573 - 27070654
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  27070573 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 27070654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27209490 - 27209449
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27209490 atttttgcctggatcgccctttcgggttttcgatccaccggg 27209449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 27239738 - 27239779
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27239738 atttttgcctggatcgccctttcgggttttcgatccaccggg 27239779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27491722 - 27491681
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27491722 atttttgcctggatcgccctttcgggttttcgatccaccggg 27491681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 28167085 - 28167044
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28167085 atttttgcctggatcgccctttcgggttttcgatccaccggg 28167044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 28214045 - 28214004
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28214045 atttttgcctggatcgccctttcgggttttcgatccaccggg 28214004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 29508008 - 29507967
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29508008 atttttgcctggatcgccctttcgggttttcgatccaccggg 29507967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 29579604 - 29579563
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29579604 atttttgcctggatcgccctttcgggttttcgatccaccggg 29579563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 30551608 - 30551649
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30551608 atttttgcctggatcgccctttcgggttttcgatccaccggg 30551649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 33370039 - 33370080
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33370039 atttttgcctggatcgccctttcgggttttcgatccaccggg 33370080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 22775499 - 22775578
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  22775499 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 22775578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 28308828 - 28308741
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||||||||  ||| |||||||||||| ||||||||||| || | ||||| || || ||||||||||||||||||||||    
T  28308828 ccctaatttttgcctggactgccttttcgggttttcaatccaccgggacgctcgtttttggcttaagccgccctttcgggttttcgac 28308741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4779405 - 4779327
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4779405 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4779327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 13517868 - 13517946
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  13517868 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 13517946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 27355785 - 27355863
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  27355785 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 27355863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28167019 - 28166941
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28167019 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28166941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 29507942 - 29507864
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  29507942 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 29507864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 34458116 - 34458154
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||||||||||||||||||||||||||||    
T  34458116 atttttgcctggatcgccctttcgggttttcgatccacc 34458154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4531878 - 4531837
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  4531878 atttttgcctggatcgccctttcgggttttcgacccaccggg 4531837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4764353 - 4764312
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  4764353 atttttgcctagatcgccctttcgggttttcgatccaccggg 4764312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4779471 - 4779430
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  4779471 atttttgcctggatcgccttttcgggttttcgatccaccggg 4779430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 13292557 - 13292598
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  13292557 atttttgcctggatcgccctttcgggttttcgacccaccggg 13292598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 13517802 - 13517843
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  13517802 atttttgcctggatcgccctctcgggttttcgatccaccggg 13517843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 16756411 - 16756370
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  16756411 atttttgcctggatcgccctttcgggttttcgacccaccggg 16756370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 24870291 - 24870254
Alignment:
Q  167 ttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||    
T  24870291 ttgcctggatcgccctttcgggttttcgatccaccggg 24870254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 26792406 - 26792365
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  26792406 atttttgcctggatcgccctttcgggttttcgatccatcggg 26792365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 131
Target Start/End: Complemental strand, 27025003 - 27024962
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgag 131  Q
    ||||||||||||||||||||||||| ||||||||||||||||    
T  27025003 gagacgctcattcttgcctgagttgtgtacaatctcagcgag 27024962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27025732 - 27025691
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  27025732 atttttgcctggatcgccctttcgggttttcgatccatcggg 27025691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27200777 - 27200736
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  27200777 atttttgcctggatcgccttttcgggttttcgatccaccggg 27200736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 27248456 - 27248497
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  27248456 atttttgcctggatcgccttttcgggttttcgatccaccggg 27248497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 27355719 - 27355760
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  27355719 atttttgcctggatcgccttttcgggttttcgatccaccggg 27355760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 30551674 - 30551755
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||| |||||||||    
T  30551674 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgagttttcgac 30551755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 18209466 - 18209509
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  18209466 ccctaatttttacctggatcgccctttcgggttttcgatccacc 18209509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 19717411 - 19717332
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  19717411 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 19717332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 20052568 - 20052615
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| |||||||||||||||||||||||||||||||  ||||||||||    
T  20052568 ccctaatttttgcctggatcgccctttcgggttttcagtccaccggga 20052615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 21362458 - 21362501
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  21362458 ccctaatttttacctggatcgccctttcgggttttcgatccacc 21362501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 22774807 - 22774890
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  22774807 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttc 22774890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 23966440 - 23966483
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  23966440 ccctaatttttacctggatcgccctttcgggttttcgatccacc 23966483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 27283970 - 27284013
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| | ||||||||||||||||||||||||||||||    
T  27283970 atttttgcctgaaccgccctttcgggttttcgatccaccgggaa 27284013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4531812 - 4531734
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  4531812 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 4531734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 4539432 - 4539510
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  4539432 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 4539510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4764287 - 4764209
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  4764287 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 4764209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 13292623 - 13292701
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  13292623 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 13292701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 14139074 - 14139152
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  14139074 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 14139152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 16680663 - 16680585
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  16680663 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 16680585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 16756345 - 16756267
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  16756345 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 16756267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 24299434 - 24299512
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24299434 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24299512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 24870229 - 24870151
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24870229 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24870151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 26110083 - 26110161
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  26110083 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 26110161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27014250 - 27014172
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  27014250 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 27014172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27025665 - 27025587
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  27025665 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 27025587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27209424 - 27209346
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||| || |||||||||||| ||||||||  |||||||||    
T  27209424 atttttgcctgaactgccctttcgggttgtcaatccagcgggatgctcatttttgcctaagccgccctcccgggttttc 27209346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 27239804 - 27239882
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||| || |||||||||||| ||||||||  |||||||||    
T  27239804 atttttgcctgaactgccctttcgggttgtcaatccagcgggatgctcatttttgcctaagccgccctcccgggttttc 27239882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28213979 - 28213901
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  28213979 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 28213901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 33370105 - 33370183
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  33370105 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 33370183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 34458182 - 34458260
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  34458182 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 34458260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 617722 - 617771
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  617722 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 617771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16584869 - 16584828
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  16584869 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 16584828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #143
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16610511 - 16610552
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  16610511 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 16610552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #144
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 18752872 - 18752913
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||| |||||||||||||||||||||||| ||||||||||||    
T  18752872 ttttacctggatcgccctttcgggttttcaatccaccgggaa 18752913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #145
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 20042454 - 20042503
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  20042454 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 20042503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #146
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 20175152 - 20175111
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||| || |||||||||||||||||||    
T  20175152 atttttgcctggatcgcccgttggggttttcgatccaccggg 20175111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #147
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22160839 - 22160880
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||| || |||||||||||||||||||    
T  22160839 atttttgcctggatcgcccgttggggttttcgatccaccggg 22160880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27053410 - 27053451
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27053410 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27053451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27069791 - 27069832
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27069791 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27069832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 27515958 - 27515909
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  27515958 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 27515909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28308890 - 28308849
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  28308890 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 28308849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 29556144 - 29556107
Alignment:
Q  167 ttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||| ||||||||||||||||||||||    
T  29556144 ttgcctggatcgccccttcgggttttcgatccaccggg 29556107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 5991853 - 5991773
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgac 244  Q
    ||||||||||| ||||| |||||||||||  |||||| ||| || || ||||| || | ||||||||||||||||||||||    
T  5991853 ttttgcctggaccgccccttcgggttttcagtccaccaggacgctcagttttggcttaagccgccctttcgggttttcgac 5991773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 227
Target Start/End: Original strand, 20053280 - 20053344
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 227  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||    
T  20053280 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgc 20053344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 25501206 - 25501286
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt-tttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||| |||||| ||||| | ||| || |||| || || || ||||||||||||||||||||||    
T  25501206 ttttgcctggaccgccctttcgagttttcaatccatcaggacgctcattcttggcttaagccgccctttcgggttttcgac 25501286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 164 - 244
Target Start/End: Original strand, 26666333 - 26666413
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  26666333 tttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 26666413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 164 - 244
Target Start/End: Original strand, 26772304 - 26772384
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  26772304 tttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 26772384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 27515889 - 27515841
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  27515889 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 27515841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 617790 - 617837
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  617790 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 617837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 201
Target Start/End: Complemental strand, 18122895 - 18122852
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||| ||||||||||||||||||||    
T  18122895 ccctaatttttacctggatcgccttttcgggttttcgatccacc 18122852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 18439299 - 18439252
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  18439299 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 18439252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 20042520 - 20042567
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  20042520 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 20042567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 21362394 - 21362433
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  21362394 ttttgcctggatcgtcctttcggattttcgatccaccggg 21362433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #164
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 23966376 - 23966415
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  23966376 ttttgcctggatcgtcctttcggattttcgatccaccggg 23966415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #165
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 24145320 - 24145367
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  24145320 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 24145367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #166
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 228
Target Start/End: Complemental strand, 27515116 - 27515053
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    ||||||||||| ||||||||||||||||   ||||||| || || |||||||||||| ||||||    
T  27515116 ttttgcctggaccgccctttcgggtttttagtccaccgagacgctcatttttgcctaagccgcc 27515053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 174483 - 174433
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||| | ||||| ||||| ||||||||||||||||| ||||||||||||    
T  174483 gtccctaacttttgtctggaccgccctttcgggttttcaatccaccgggaa 174433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 15406207 - 15406285
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||| ||||| |||||||||    
T  15406207 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccacccttccgggttttc 15406285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 15417994 - 15418072
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||| ||||| |||||||||    
T  15417994 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccacccttccgggttttc 15418072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 26792340 - 26792262
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| ||||||||| |||||||||    
T  26792340 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgcccttccgggttttc 26792262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 26927276 - 26927198
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||| ||||||| | |||||||||||||||||    
T  26927276 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcattcttgcctaagtcgccctttcgggttttc 26927198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27031544 - 27031466
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| |||||||||    
T  27031544 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcctttttgcctaagccgcccttccgggttttc 27031466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Original strand, 27052445 - 27052487
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  27052445 ccctaatttttacctggaccgccctttcgggttttcgatccac 27052487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27064005 - 27063927
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||| |||||| || ||||| ||||  || |||||||| ||| |||||||||||||||||||    
T  27064005 atttttgcctgaactgcccttccgggttgtcaatccagcggggtgctcatttttgtctaagccgccctttcgggttttc 27063927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 29579538 - 29579460
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| |  ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  29579538 atttttgcctgaactgccctttcgggttgttaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 29579460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16584787 - 16584746
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  16584787 ttttacctggaccgccctttcgggttttcaatccaccgggaa 16584746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16610593 - 16610634
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  16610593 ttttacctggaccgccctttcgggttttcaatccaccgggaa 16610634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 242
Target Start/End: Complemental strand, 16640668 - 16640583
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcg 242  Q
    |||| ||||||||||||| | |||||||||||||| ||||||||  |  || || ||||||| || ||||||| ||||||||||||    
T  16640668 ccctaatttttgcctggaccaccctttcgggtttttgatccaccaaggtgctcattttttgcttaagccgcccattcgggttttcg 16640583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 16937699 - 16937780
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||  ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  16937699 atttttgcctgaactgccctttcgggttgtcaatccggcggggtgctcattcttgcctaagccgcccttccgggttttcgac 16937780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 24145261 - 24145302
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||||||||| ||||||||||||||||  |||||||||||    
T  24145261 ttttgcctggattgccctttcgggttttcagtccaccgggaa 24145302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 240
Target Start/End: Complemental strand, 29556082 - 29556005
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtttt 240  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||| | |||||||||    
T  29556082 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccttctcgggtttt 29556005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #182
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 164 - 244
Target Start/End: Original strand, 23878677 - 23878756
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||||||  |||||||||||||||| | |||||||  | || |||||||||||| |||||| |||| ||||| ||||    
T  23878677 tttttgcctgggccgccctttcgggttttag-tccaccgaaacgctcatttttgcctaagccgccatttcaggtttgcgac 23878756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 210)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 13181082 - 13181297
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
T  13181082 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggatcgccctttcgggt 13181181  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  13181182 tttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 13181281  T
Q  290 ctatatcagcattcac 305  Q
    | ||||||||||||||    
T  13181282 ccatatcagcattcac 13181297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 43084126 - 43083911
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  43084126 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 43084027  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  43084026 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 43083927  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  43083926 ctatatcggcattcac 43083911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 25270303 - 25270086
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||| |||||||||||| |||||||||||||    
T  25270303 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgttttttttttgtcccttgtttttgcctggaccgccctttcgggt 25270204  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  25270203 tttcgatccaccgggaagcgcatttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatttaggcaaagtatttcttga 25270105  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  25270104 ctatatcagcattcacagg 25270086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 30157901 - 30157687
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  30157901 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggt 30157803  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  30157802 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 30157703  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  30157702 ctatatcagcattcac 30157687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 33880995 - 33880784
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  33880995 gagacgctcatttttgcctgagttgcgaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 33880900  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  33880899 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 33880800  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  33880799 ctatatcagcattcac 33880784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 25206147 - 25205931
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||         | |||||| |||||||||||| |||||||||||||    
T  25206147 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgtttttttttg-tcccttgtttttgcctggaccgccctttcgggt 25206049  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  25206048 tttcgatccaccgggaagcgcatttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatttaggcaaagtatttcttga 25205950  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  25205949 ctatatcagcattcacagg 25205931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 9545001 - 9545213
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  9545001 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 9545097  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  9545098 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 9545197  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  9545198 ctatatcggcattcac 9545213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 13436974 - 13437187
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  13436974 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 13437071  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  13437072 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 13437171  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  13437172 ctatatcagcattcac 13437187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 23897743 - 23897528
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  23897743 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggt 23897648  T
Q  190 ttt-cgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  23897647 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 23897548  T
Q  289 actatatcagcattcacagg 308  Q
    ||||||||||||||||||||    
T  23897547 actatatcagcattcacagg 23897528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 30035295 - 30035084
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  30035295 gagacgctcatttttgcctgagttgcgaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 30035200  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  30035199 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 30035100  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  30035099 ctatatcggcattcac 30035084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 31437332 - 31437120
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  31437332 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 31437236  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  31437235 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 31437136  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31437135 ctatatcggcattcac 31437120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 37746620 - 37746833
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  37746620 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 37746717  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  37746718 tttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 37746817  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  37746818 ctatatcggcattcac 37746833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 40467846 - 40468054
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||           |||||||||||||||||||| |||||||||||||    
T  40467846 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatattttttt-------gtcccttatttttgcctggaccgccctttcgggt 40467938  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  40467939 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 40468038  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  40468039 ctatatcggcattcac 40468054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 304
Target Start/End: Complemental strand, 24975717 - 24975504
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |          | ||||||||||||||||||| |||||||||||||    
T  24975717 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatatatttttttg-tcccttatttttgcctggaccgccctttcgggt 24975619  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  24975618 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 24975519  T
Q  290 ctatatcagcattca 304  Q
    |||||||||||||||    
T  24975518 ctatatcagcattca 24975504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 6880171 - 6879961
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  6880171 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttctt----gtcccttatttttgcctggaccgccctttcgggt 6880077  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  6880076 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 6879977  T
Q  290 ctatatcagcattcac 305  Q
     |||||| ||||||||    
T  6879976 ttatatcggcattcac 6879961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 8659765 - 8659979
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||         | ||||||||||||||||||| |||||||||||||    
T  8659765 gagacgctcattcttgcctgagttgcgaacaacctcagcgagctttttcatatttgtttttttgtg-tcccttatttttgcctggaccgccctttcgggt 8659863  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  8659864 tttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 8659963  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  8659964 ctatatcggcattcac 8659979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 13319120 - 13319334
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||  |          | ||||||||||||||||||| |||||||||||||    
T  13319120 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatacatatttttttttg-tcccttatttttgcctggaccgccctttcgggt 13319218  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  13319219 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 13319318  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  13319319 ctatatcggcattcac 13319334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 23631837 - 23631625
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  23631837 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 23631741  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  23631740 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 23631641  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  23631640 ctatatcggcattcac 23631625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 24729838 - 24729625
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  24729838 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 24729741  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  24729740 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 24729641  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  24729640 ctatatcagcattcac 24729625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 34622386 - 34622174
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  34622386 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttgt--gtcccttatttttgcctggaccgccctttcgggt 34622290  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  34622289 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 34622190  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  34622189 ctatatcggcattcac 34622174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 33783355 - 33783141
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgt--acaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||    
T  33783355 gagacgctcattcttgcctgagttgcgtgtacaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgg 33783259  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  33783258 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 33783159  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||||||||||||    
T  33783158 gactatatcagcattcac 33783141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 11329505 - 11329293
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||    
T  11329505 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggt 11329409  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  11329408 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 11329309  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  11329308 ctatatcggcattcac 11329293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 12138044 - 12137831
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  12138044 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggt 12137947  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  12137946 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 12137847  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  12137846 ctatatcggcattcac 12137831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 15653051 - 15653261
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  15653051 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 15653145  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  15653146 tttcgatccaccgggaagcgcatttttgcccaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 15653245  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  15653246 ctatatcggcattcac 15653261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 15753144 - 15753356
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||          |||||||||||||||||||| |||||||||||||    
T  15753144 gagacgctcattcttgcctgatttgcgtacaatctcagcgagctttt-catgtttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 15753240  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  15753241 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 15753340  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  15753341 ctatatcggcattcac 15753356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 28655110 - 28654899
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  28655110 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 28655015  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  28655014 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 28654915  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  28654914 ctatatcggcattcac 28654899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 32590568 - 32590778
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| |||||||           |||||||||||||||||||| |||||||||||||    
T  32590568 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttatttttt----gtcccttatttttgcctggaccgccctttcgggt 32590662  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  32590663 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 32590762  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  32590763 ctatatcagcattcac 32590778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 37352937 - 37353147
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  37352937 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 37353031  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  37353032 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 37353131  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  37353132 ctatatcggcattcac 37353147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 37760850 - 37760639
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  37760850 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 37760755  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  37760754 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 37760655  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  37760654 ctatatcggcattcac 37760639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 18495060 - 18495276
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||    
T  18495060 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgg 18495158  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  18495159 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 18495258  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  18495259 gactatatcggcattcac 18495276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 28954073 - 28954289
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||    
T  28954073 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgg 28954171  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||    
T  28954172 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttctt 28954271  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  28954272 gactatatcggcattcac 28954289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 22894285 - 22894064
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng----gtcccttatttttgcctggatcgccctttc 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||              |||||||||||||||||||| |||||||||    
T  22894285 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttttttttttgtcccttatttttgcctggaccgccctttc 22894187  T
Q  186 gggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttc 285  Q
    ||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  22894186 gggtttttgatccaccgcgaagcgcatttttgcctaggtcgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttc 22894087  T
Q  286 ttgactatatcagcattcacagg 308  Q
    |||||||||||||||||||||||    
T  22894086 ttgactatatcagcattcacagg 22894064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 26486264 - 26486050
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||    
T  26486264 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttttcatatatatatttttt--gtcccttatttttgcctggaccgccctttcggg 26486167  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||    
T  26486166 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttg 26486067  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  26486066 actatatcggcattcac 26486050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 3795406 - 3795197
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  3795406 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 3795313  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  3795312 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 3795213  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  3795212 ctatatcggcattcac 3795197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 9323345 - 9323132
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  9323345 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggt 9323248  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  9323247 tttcgatccaccgggaagcgcattcttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 9323148  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  9323147 ctatatcggcattcac 9323132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 18122709 - 18122920
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| | |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  18122709 gagacgctcattcttgcctgagttgcatgcaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggt 18122804  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18122805 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18122904  T
Q  290 ctatatcagcattcac 305  Q
    ||| ||| ||||||||    
T  18122905 ctacatcggcattcac 18122920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 18369825 - 18370038
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||| ||||         | ||||||||||||||||||| |||||||||||||    
T  18369825 gagacgctcattcttgcctgagttgtatacaatctcagcgagctttt-catttttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 18369922  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18369923 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18370022  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18370023 ctatatcggcattcac 18370038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 30174333 - 30174125
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  30174333 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatttttt------gtcccttatttttgcctggaccgccctttcgggt 30174241  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  30174240 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 30174141  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  30174140 ctatatcggcattcac 30174125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 31820701 - 31820911
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  31820701 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 31820795  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||| |||||||||||||    
T  31820796 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatattcttaggcaaagtatttcttga 31820895  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31820896 ctatatcggcattcac 31820911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 37665779 - 37665990
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  37665779 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 37665874  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  37665875 tttcggcccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 37665974  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  37665975 ctatatcggcattcac 37665990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 41680572 - 41680361
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  41680572 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 41680477  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  41680476 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 41680377  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  41680376 ctatatcggcattcac 41680361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 90 - 296
Target Start/End: Complemental strand, 24608114 - 24607910
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  24608114 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 24608017  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  24608016 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 24607917  T
Q  290 ctatatc 296  Q
    |||||||    
T  24607916 ctatatc 24607910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 90 - 303
Target Start/End: Complemental strand, 33298401 - 33298186
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng---gtcccttatttttgcctggatcgccctttcg 186  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||             |||||||||||||||||||| ||||||||||    
T  33298401 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttttttgtcccttatttttgcctggaccgccctttcg 33298303  T
Q  187 ggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttct 286  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||    
T  33298302 ggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttct 33298203  T
Q  287 tgactatatcagcattc 303  Q
    |||||||||| ||||||    
T  33298202 tgactatatcggcattc 33298186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 2516933 - 2516718
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||    
T  2516933 gagacgctcattcttgcctgagttgtgtataatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcggg 2516835  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||    
T  2516834 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttg 2516735  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  2516734 actatatcggcattcac 2516718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 11555222 - 11555011
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||| ||||||| |||||||||||||    
T  11555222 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatattttttttt---gtcccttatttt-gcctggaccgccctttcgggt 11555127  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  11555126 tttcgatccaccgggaagcgcatttttacctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 11555027  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  11555026 ctatatcggcattcac 11555011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 22993409 - 22993621
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||    
T  22993409 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcaaatattttttttt---gtcccttatttttgcctggaccgccctttcgggt 22993505  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  22993506 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcaggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 22993605  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  22993606 ctatatcggcattcac 22993621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 30940504 - 30940291
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||| ||||||||||| ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||    
T  30940504 gagacgctcattcctgcctgagttgtgtacaatctcagcgagctttt-catatatatatttttttg-tcccttatttttgcctggaccgccctttcgggt 30940407  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  30940406 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 30940307  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  30940306 ctatatcggcattcac 30940291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 33522247 - 33522036
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  33522247 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 33522152  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  33522151 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 33522052  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  33522051 ctatatcggcattcac 33522036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 305
Target Start/End: Complemental strand, 5643593 - 5643444
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5643593 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 5643494  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    ||||||||| || |||||||||||||||||||||||||||| ||||||||    
T  5643493 ttcttttcacatttctaggcgaagtatttcttgactatatcggcattcac 5643444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 179 - 308
Target Start/End: Original strand, 29885575 - 29885704
Alignment:
Q  179 ccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaa 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||    
T  29885575 ccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgttgttcctttcatatatctaggcgaa 29885674  T
Q  279 gtatttcttgactatatcagcattcacagg 308  Q
    ||||||||||||||||||  ||||||||||    
T  29885675 gtatttcttgactatatcgacattcacagg 29885704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 3481589 - 3481734
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  3481589 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 3481688  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  3481689 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 3481734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 20375015 - 20375162
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  20375015 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 20375114  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | |||| ||| | |||||||||||||||  ||||| |||||||||    
T  20375115 tatacatatttagacaaagtatttcttgactgcatcagaattcacagg 20375162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 261
Target Start/End: Original strand, 5437611 - 5437710
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  5437611 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 5437710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 261
Target Start/End: Original strand, 11941808 - 11941907
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  11941808 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 11941907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 158 - 243
Target Start/End: Original strand, 21862452 - 21862538
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcga 243  Q
    |||| ||||||||||||| ||||||||||||||||| ||||||||||| || ||||||| || || |||||||||||||||||||||    
T  21862452 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacgctcatttttggcttaagccgccctttcgggttttcga 21862538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 90 - 145
Target Start/End: Complemental strand, 5643670 - 5643616
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttg 145  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  5643670 gagacgctcattcttgcctgagttgcgtacaatctcagcgagc-ttttcatatttg 5643616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 21990740 - 21990827
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  21990740 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 21990827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 27228714 - 27228801
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  27228714 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcactttttgcttaagccgccctttcgggttttcgac 27228801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 163 - 291
Target Start/End: Original strand, 15782109 - 15782239
Alignment:
Q  163 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | |||||||| |||||||||||| ||||  |||||||||    
T  15782109 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 15782208  T
Q  261 ttcatatatctaggcgaagtatttcttgact 291  Q
    || | || | ||| | |||||||||||||||    
T  15782209 ttaaaatttttagacaaagtatttcttgact 15782239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 291
Target Start/End: Complemental strand, 31523082 - 31522953
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc-ctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||  ||||||||||||||| ||||  ||||||||||    
T  31523082 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcctttttcgggttttcgacttaccgagctgttcttt 31522983  T
Q  262 tcatatatctaggcgaagtatttcttgact 291  Q
    | |  | | ||| | |||||||||||||||    
T  31522982 taaagtttttagacaaagtatttcttgact 31522953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 12175675 - 12175755
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  12175675 ttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 12175755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 163 - 309
Target Start/End: Complemental strand, 17959873 - 17959725
Alignment:
Q  163 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  17959873 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 17959774  T
Q  261 ttcatatatctaggcgaagtatttcttgactatatcagcattcacaggt 309  Q
    || |  | | ||| | ||||||||||||||| |||| |  |||||||||    
T  17959773 ttaaagtttttagacaaagtatttcttgactgtatccgtgttcacaggt 17959725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 11808515 - 11808602
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  11808515 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 11808602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 26084454 - 26084541
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  26084454 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 26084541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 28849287 - 28849200
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  28849287 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 28849200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 29899159 - 29899076
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  29899159 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 29899076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 163 - 261
Target Start/End: Original strand, 36373346 - 36373445
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  ||||||||||    
T  36373346 attttttcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttcttt 36373445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 163 - 261
Target Start/End: Original strand, 36998000 - 36998099
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  ||||||||||    
T  36998000 attttttcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttcttt 36998099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 2517666 - 2517625
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2517666 atttttgcctggatcgccctttcgggttttcgatccaccggg 2517625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 6880904 - 6880863
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  6880904 atttttgcctggatcgccctttcgggttttcgatccaccggg 6880863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 9324076 - 9324035
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9324076 atttttgcctggatcgccctttcgggttttcgatccaccggg 9324035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 9544268 - 9544309
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9544268 atttttgcctggatcgccctttcgggttttcgatccaccggg 9544309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 11555953 - 11555912
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  11555953 atttttgcctggatcgccctttcgggttttcgatccaccggg 11555912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 12138775 - 12138734
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12138775 atttttgcctggatcgccctttcgggttttcgatccaccggg 12138734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 13180354 - 13180395
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  13180354 atttttgcctggatcgccctttcgggttttcgatccaccggg 13180395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 13318389 - 13318430
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  13318389 atttttgcctggatcgccctttcgggttttcgatccaccggg 13318430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15652322 - 15652363
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15652322 atttttgcctggatcgccctttcgggttttcgatccaccggg 15652363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 18369093 - 18369134
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18369093 atttttgcctggatcgccctttcgggttttcgatccaccggg 18369134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 18494329 - 18494370
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18494329 atttttgcctggatcgccctttcgggttttcgatccaccggg 18494370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22992685 - 22992726
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22992685 atttttgcctggatcgccctttcgggttttcgatccaccggg 22992726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 23632571 - 23632530
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  23632571 atttttgcctggatcgccctttcgggttttcgatccaccggg 23632530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 23726835 - 23726794
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  23726835 atttttgcctggatcgccctttcgggttttcgatccaccggg 23726794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 24730570 - 24730529
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24730570 atttttgcctggatcgccctttcgggttttcgatccaccggg 24730529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 24976443 - 24976402
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24976443 atttttgcctggatcgccctttcgggttttcgatccaccggg 24976402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 25206884 - 25206843
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  25206884 atttttgcctggatcgccctttcgggttttcgatccaccggg 25206843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 25271040 - 25270999
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  25271040 atttttgcctggatcgccctttcgggttttcgatccaccggg 25270999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 26486985 - 26486944
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26486985 atttttgcctggatcgccctttcgggttttcgatccaccggg 26486944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 28953339 - 28953380
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28953339 atttttgcctggatcgccctttcgggttttcgatccaccggg 28953380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 30175066 - 30175025
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30175066 atttttgcctggatcgccctttcgggttttcgatccaccggg 30175025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 30941231 - 30941190
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30941231 atttttgcctggatcgccctttcgggttttcgatccaccggg 30941190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 31438057 - 31438016
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31438057 atttttgcctggatcgccctttcgggttttcgatccaccggg 31438016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 33299137 - 33299096
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33299137 atttttgcctggatcgccctttcgggttttcgatccaccggg 33299096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 33522917 - 33522836
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  33522917 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 33522836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 37352205 - 37352246
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  37352205 atttttgcctggatcgccctttcgggttttcgatccaccggg 37352246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 40467112 - 40467153
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40467112 atttttgcctggatcgccctttcgggttttcgatccaccggg 40467153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 41681305 - 41681264
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  41681305 atttttgcctggatcgccctttcgggttttcgatccaccggg 41681264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 43084857 - 43084816
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  43084857 atttttgcctggatcgccctttcgggttttcgatccaccggg 43084816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 20382474 - 20382387
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||||||||  ||| |||||||||||| ||||||||||| || | ||||| || || ||||||||||||||||||||||    
T  20382474 ccctaatttttgcctggactgccttttcgggttttcaatccaccgggacgctcgtttttggcttaagccgccctttcgggttttcgac 20382387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 21692730 - 21692651
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  21692730 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 21692651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 23898467 - 23898428
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  23898467 ttttgcctggatcgccctttcgggttttcgatccaccggg 23898428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 33839997 - 33840084
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||||||||  ||| |||||||||||| ||||||||||| || | ||||| || || ||||||||||||||||||||||    
T  33839997 ccctaatttttgcctggactgccttttcgggttttcaatccaccgggacgctcgtttttggcttaagccgccctttcgggttttcgac 33840084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 3796073 - 3795995
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  3796073 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 3795995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 3796139 - 3796101
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||||||||||||||||||||||||||||    
T  3796139 atttttgcctggatcgccctttcgggttttcgatccacc 3796101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 6880838 - 6880760
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  6880838 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 6880760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 15752485 - 15752563
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  15752485 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 15752563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 18369159 - 18369237
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  18369159 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 18369237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 23632505 - 23632427
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  23632505 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 23632427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28655777 - 28655699
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28655777 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28655699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 30035960 - 30035882
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  30035960 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 30035882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 30158568 - 30158490
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  30158568 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 30158490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 32589903 - 32589981
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || | ||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  32589903 atttttgcctgaattgtcctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 32589981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 33881660 - 33881582
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  33881660 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 33881582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 41681239 - 41681161
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  41681239 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 41681161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 8659033 - 8659074
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  8659033 atttttgcctggatcgccctctcgggttttcgatccaccggg 8659074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 11330239 - 11330198
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||| ||||||||||||||||||||||||||||||||    
T  11330239 atttttgccaggatcgccctttcgggttttcgatccaccggg 11330198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 13436231 - 13436272
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||| |||||||||||||||||||||||||||    
T  13436231 atttttgcctggattgccctttcgggttttcgatccaccggg 13436272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15752419 - 15752460
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  15752419 atttttgcctggatcgccctttcgggttttcggtccaccggg 15752460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 20374383 - 20374460
Alignment:
Q  165 ttttgcctggatcgccctttcggg-ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |||||||| ||| ||||| ||||||||||| || | |||||||||| |||||||||| ||||||||    
T  20374383 ttttgcctggaccgcccttttggggttttcaatccaccgggatgctcttttttgcctaagccgcccttttgggttttc 20374460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 28655843 - 28655802
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  28655843 atttttgcctggatcgccctttcgggttttcgacccaccggg 28655802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 30036026 - 30035985
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  30036026 atttttgcctggatcgccctttcgggttttcggtccaccggg 30035985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 30158634 - 30158593
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  30158634 atttttgcctggatcgccctttcgggttttcggtccaccggg 30158593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31819974 - 31820015
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  31819974 atttttgcctggatcgccctttcgggttttcaatccaccggg 31820015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 33522983 - 33522942
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||| |||||||||||    
T  33522983 atttttgcctggatcgccctttcgggtttttgatccaccggg 33522942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 33881726 - 33881685
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  33881726 atttttgcctggatcgccctctcgggttttcgatccaccggg 33881685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 34623120 - 34623079
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  34623120 atttttgcctggatcgccctttcgggttttcgacccaccggg 34623079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 37352271 - 37352352
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  37352271 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 37352352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 37665046 - 37665087
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  37665046 atttttgcctggatcgccttttcgggttttcgatccaccggg 37665087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 37761580 - 37761539
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||| ||||||    
T  37761580 atttttgcctggatcgccctttcgggttttcgatcaaccggg 37761539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 260
Target Start/End: Complemental strand, 34471381 - 34471297
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  34471381 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 34471297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 24959875 - 24959962
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||||| || |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  24959875 ccctaatttttgcctagaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 24959962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 37582584 - 37582505
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  37582584 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 37582505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5644332 - 5644254
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  5644332 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 5644254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 8659099 - 8659177
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  8659099 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 8659177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 9324010 - 9323932
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  9324010 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 9323932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 9544334 - 9544412
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  9544334 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 9544412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 11330173 - 11330095
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  11330173 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 11330095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 12138709 - 12138631
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  12138709 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 12138631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 13180420 - 13180498
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  13180420 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 13180498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 13318455 - 13318533
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  13318455 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 13318533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 15652387 - 15652465
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  15652387 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 15652465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 18122043 - 18122121
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| || ||||||||||||||||    
T  18122043 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagctgccctttcgggttttc 18122121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 18494395 - 18494473
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  18494395 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 18494473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 22894950 - 22894872
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  22894950 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 22894872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 22895016 - 22894978
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||| ||||||||||||||||||||||||||||    
T  22895016 atttttgcctagatcgccctttcgggttttcgatccacc 22894978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 233
Target Start/End: Original strand, 22953997 - 22954067
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 233  Q
    ||||||||||||| |||||||||  |||||| |||||||| || || |||||||||||| |||||| ||||    
T  22953997 atttttgcctggaccgccctttcaagttttcaatccaccgagacgctcatttttgcctaagccgccttttc 22954067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 23898403 - 23898325
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| ||| |||| ||||  || |||||||||||| ||||||||| |||||||||    
T  23898403 atttttgcctgaactgccctttcgggttgtcggtccagcggggtgctcatttttgcctaagccgcccttccgggttttc 23898325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 24608775 - 24608697
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24608775 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24608697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 24730504 - 24730426
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24730504 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24730426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 25206818 - 25206740
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  25206818 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 25206740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 25270974 - 25270896
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  25270974 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 25270896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 26486919 - 26486841
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  26486919 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 26486841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 30175000 - 30174922
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  30175000 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 30174922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 30941164 - 30941086
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  30941164 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 30941086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 33784016 - 33783938
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  33784016 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 33783938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 37665113 - 37665191
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  37665113 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 37665191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 37745949 - 37746027
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || ||||||||||||   |||||||||||||||||    
T  37745949 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaaatcgccctttcgggttttc 37746027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 43084791 - 43084713
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || |||||||| |||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  43084791 atttttgcctgaattgccctttctggttatcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 43084713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 220 - 308
Target Start/End: Original strand, 349655 - 349746
Alignment:
Q  220 taggccgccctttcgggttttcgacctaccacgctgttctttt---catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |||| |||||||||||||||||||||||||    |||||||||    |||||||||| | |||||||||||||||  ||||| |||||||||    
T  349655 taggacgccctttcgggttttcgacctaccgaattgttcttttacatatatatctagacaaagtatttcttgactgcatcagaattcacagg 349746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 1803838 - 1803789
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  1803838 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 1803789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5644398 - 5644357
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||| || ||||||||||    
T  5644398 atttttgcctggatcgccctttcgggttgtcaatccaccggg 5644357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 7792536 - 7792487
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  7792536 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 7792487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 11808451 - 11808492
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  11808451 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 11808492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 12389769 - 12389818
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  12389769 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 12389818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 15781324 - 15781373
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  15781324 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 15781373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 20382550 - 20382509
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  20382550 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 20382509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #166
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 21693516 - 21693467
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  21693516 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 21693467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #167
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 21862384 - 21862425
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  21862384 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 21862425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #168
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 24608841 - 24608800
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||| |||||||| ||||||||||||||||||||||||||    
T  24608841 attttttcctggatcaccctttcgggttttcgatccaccggg 24608800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #169
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 26084390 - 26084431
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  26084390 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 26084431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #170
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27228650 - 27228691
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27228650 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27228691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #171
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 28849348 - 28849307
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  28849348 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 28849307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #172
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 28953405 - 28953486
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  |||||||| ||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  28953405 atttttgcctgaactgccctttcaggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttcgac 28953486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #173
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 31523856 - 31523807
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  31523856 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 31523807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #174
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 32589838 - 32589878
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||| ||||||||||||||||||    
T  32589838 atttttgcctggatcgccctttc-ggttttcgatccaccggg 32589878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #175
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 33784082 - 33784041
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||||||||||||| ||||||||    
T  33784082 atttttgcatggatcgccctttcgggttttcgacccaccggg 33784041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #176
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 33839934 - 33839975
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
T  33839934 ttttgcctggaccgcccttttgggttttcgatccaccgggaa 33839975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #177
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 36372617 - 36372666
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  36372617 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 36372666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #178
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 36997280 - 36997329
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  36997280 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 36997329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #179
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 37745883 - 37745924
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||| |||||||||||||||||||| ||||||||||    
T  37745883 atttttgcctagatcgccctttcgggttttcaatccaccggg 37745924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #180
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 12389840 - 12389916
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  12389840 ttttgcctggaccgccctttcgggttttcagtccaccgggacgctctctgttgcctaagccgccttttcaggttttc 12389916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 1803772 - 1803725
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  1803772 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 1803725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 3480908 - 3480951
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||||||| ||||||||||||||||    
T  3480908 ccctaatttttacctggatcgcccttttgggttttcgatccacc 3480951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 7256580 - 7256627
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  7256580 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 7256627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 7792470 - 7792423
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  7792470 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 7792423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 11941142 - 11941189
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  11941142 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 11941189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 15781388 - 15781435
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  15781388 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 15781435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 31523787 - 31523740
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  31523787 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 31523740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #188
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 36372683 - 36372730
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  36372683 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 36372730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #189
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 36452020 - 36451941
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| | |||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  36452020 ttttgcctggaccacccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 36451941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #190
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 36997346 - 36997393
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  36997346 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 36997393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 2517600 - 2517522
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || || || ||||  || |||||||||||| ||| |||||||||||||||    
T  2517600 atttttgcctgaactgccctttcgggttgtcaattcagcggggtgctcatttttgcctaagccaccctttcgggttttc 2517522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #192
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 11555887 - 11555809
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| |||||||||    
T  11555887 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcttttttgcctaagccgcccttccgggttttc 11555809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 13436297 - 13436375
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | || ||||||||||||||    
T  13436297 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgtcctttcgggttttc 13436375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #194
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 22992751 - 22992829
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| ||||||||| |||||||||    
T  22992751 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgcccttccgggttttc 22992829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #195
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 24976377 - 24976299
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | ||||||| |||||||||    
T  24976377 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagacgcccttccgggttttc 24976299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Original strand, 27227697 - 27227739
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  27227697 ccctaatttttacctggaccgccctttcgggttttcgatccac 27227739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 31437991 - 31437913
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| || |  || |||| ||||||| ||||||||| |||||||||    
T  31437991 atttttgcctgaactgccctttcgggttttcaatccagcgaggtgctcattcttgcctaagccgcccttccgggttttc 31437913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 31820037 - 31820115
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||| |||| |||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31820037 atttttgcctgaactgccttttcaggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31820115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #199
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 33299071 - 33298993
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| || |||||| |||||||||    
T  33299071 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagctgcccttccgggttttc 33298993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 7256515 - 7256564
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||| ||||||||||||  |||||||||||    
T  7256515 tccctaatttttgcctggaccgccttttcgggttttcagtccaccgggaa 7256564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #201
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 226
Target Start/End: Original strand, 7257278 - 7257339
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccg 226  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| ||||    
T  7257278 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccg 7257339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 11807500 - 11807537
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  11807500 tttttgcctggaccgccctttcgggtttttgatccacc 11807537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 11941085 - 11941126
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  11941085 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 11941126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 12174688 - 12174725
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  12174688 tttttgcctggaccgccctttcgggtttttgatccacc 12174725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 23641642 - 23641605
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcga 195  Q
    |||| ||||||||||||| |||||||||||||||||||    
T  23641642 ccctaatttttgcctggaccgccctttcgggttttcga 23641605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 23641706 - 23641665
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||| ||| ||||||||||||    
T  23641706 ttttgcctggaccgccctttcgggtcttcaatccaccgggaa 23641665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 23831175 - 23831216
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||| ||| ||||||||||||    
T  23831175 ttttgcctggaccgccctttcgggtcttcaatccaccgggaa 23831216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 23831239 - 23831276
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcga 195  Q
    |||| ||||||||||||| |||||||||||||||||||    
T  23831239 ccctaatttttgcctggaccgccctttcgggttttcga 23831276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 260
Target Start/End: Original strand, 24064566 - 24064651
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 260  Q
    |||||||||||||||||   |||||| || || ||||||| ||||| |||||||||| |||||||||||| ||||  |||||||||    
T  24064566 cgccctttcgggttttcagcccaccgagacgctcattttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 24064651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 26083414 - 26083451
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  26083414 tttttgcctggaccgccctttcgggtttttgatccacc 26083451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 242)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 19700311 - 19700096
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  19700311 gagacgcttattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 19700215  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  19700214 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatttaggcaaagtatttcttga 19700115  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  19700114 ctatatcagcattcacagg 19700096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 15887143 - 15887358
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  15887143 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatattttttttt---gtcccttatttttgcctggaccgccctttcgggt 15887239  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  15887240 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 15887339  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  15887340 ctatatcagcattcacagg 15887358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 47029277 - 47029063
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  47029277 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggt 47029179  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  47029178 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 47029079  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  47029078 ctatatcagcattcac 47029063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 16422008 - 16421792
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  16422008 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 16421911  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||| |||||||||||||    
T  16421910 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatattcctaggcaaagtatttcttga 16421811  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  16421810 ctatatcagcattcacagg 16421792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5472812 - 5472598
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  5472812 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 5472714  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5472713 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5472614  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5472613 ctatatcggcattcac 5472598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5716892 - 5716684
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  5716892 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttt------gtcccttatttttgcctggaccgccctttcgggt 5716800  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5716799 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5716700  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5716699 ctatatcggcattcac 5716684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 5764566 - 5764774
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  5764566 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttt------gtcccttatttttgcctggaccgccctttcgggt 5764658  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5764659 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5764758  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5764759 ctatatcggcattcac 5764774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 18231017 - 18230806
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  18231017 gagacgctcatttttgcctgagttgcgaacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 18230922  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18230921 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18230822  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18230821 ctatatcggcattcac 18230806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 4689474 - 4689262
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  4689474 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcgggt 4689381  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||    
T  4689380 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcaacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 4689281  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  4689280 ctatatcagcattcacagg 4689262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 16618928 - 16619143
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||          |||||||||||| ||||||| |||||||||||||    
T  16618928 gagacgctcattcttacctaagttgcgtacaatctcagcgagctttttcatatttgtttttttt--gtcccttatttt-gcctggaccgccctttcgggt 16619024  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  16619025 tttcgatccacccggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttga 16619124  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  16619125 ctatatcagcattcacagg 16619143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5019537 - 5019324
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  5019537 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 5019440  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5019439 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5019340  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5019339 ctatatcggcattcac 5019324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 5603751 - 5603964
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  5603751 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 5603848  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5603849 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5603948  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5603949 ctatatcggcattcac 5603964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5727802 - 5727594
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  5727802 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttt------gtcccttatttttgcctggaccgccctttcgggt 5727710  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5727709 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcaacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5727610  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5727609 ctatatcggcattcac 5727594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 18248562 - 18248351
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  18248562 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 18248467  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18248466 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18248367  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18248366 ctatatcggcattcac 18248351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 29143193 - 29143406
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  29143193 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 29143290  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  29143291 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 29143390  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  29143391 ctatatcggcattcac 29143406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 31958893 - 31959105
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  31958893 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 31958989  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  31958990 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 31959089  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31959090 ctatatcggcattcac 31959105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 48471751 - 48471537
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  48471751 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 48471653  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  48471652 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 48471553  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  48471552 ctatatcggcattcac 48471537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 51787846 - 51787633
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  51787846 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 51787749  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  51787748 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 51787649  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  51787648 ctatatcggcattcac 51787633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 4341113 - 4341326
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  4341113 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 4341210  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  4341211 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 4341310  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  4341311 ctatatcggcattcac 4341326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 4629609 - 4629395
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| || |||||          |||||||||||||||||||| |||||||||||||    
T  4629609 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttt-cacatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 4629511  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  4629510 tttcgatccaccgggaagcgtatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 4629411  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  4629410 ctatatcggcattcac 4629395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5657959 - 5657747
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  5657959 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 5657863  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5657862 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5657763  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  5657762 ctatatcagcattcac 5657747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 8002384 - 8002170
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  8002384 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatattttttttttgtcccttatttttgcctggaccgccctttcgggt 8002286  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  8002285 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 8002186  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  8002185 ctatatcggcattcac 8002170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 8217456 - 8217244
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  8217456 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 8217360  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  8217359 tttcgatccaccgggaagcgcatttttgcctaggtcgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 8217260  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  8217259 ctatatcggcattcac 8217244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 8283905 - 8284119
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||| |||||||| ||||||||||||||||||||||||||| |          | ||||||||||||||||||| |||||||||||||    
T  8283905 gagacgctcattcttgtctgagttgtgtacaatctcagcgagctttttcatatatatttttttttg-tcccttatttttgcctggaccgccctttcgggt 8284003  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  8284004 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 8284103  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  8284104 ctatatcggcattcac 8284119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 17971300 - 17971511
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  17971300 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 17971395  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  17971396 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 17971495  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  17971496 ctatatcggcattcac 17971511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 20571282 - 20571493
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  20571282 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 20571377  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  20571378 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 20571477  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  20571478 ctatatcggcattcac 20571493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 28110392 - 28110604
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  28110392 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggt 28110488  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||    
T  28110489 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttga 28110588  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  28110589 ctatatcggcattcac 28110604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 31030674 - 31030886
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||| ||    
T  31030674 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgagt 31030770  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  31030771 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 31030870  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31030871 ctatatcggcattcac 31030886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 35886588 - 35886376
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |           |||||||||||||||||||| |||||| ||||||    
T  35886588 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctatcgggt 35886492  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  35886491 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 35886392  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  35886391 ctatatcggcattcac 35886376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 22865282 - 22865498
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||    
T  22865282 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgg 22865380  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  22865381 gttttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 22865480  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  22865481 gactatatcggcattcac 22865498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 22880341 - 22880557
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||    
T  22880341 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgg 22880439  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  22880440 gttttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 22880539  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  22880540 gactatatcggcattcac 22880557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 29659404 - 29659620
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||    
T  29659404 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgg 29659502  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  29659503 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 29659602  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  29659603 gactatatcggcattcac 29659620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 32444978 - 32444761
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |             |||||||||||||||||||| |||||||||||    
T  32444978 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatatatatattttttgtcccttatttttgcctggaccgccctttcgg 32444879  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  32444878 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 32444779  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  32444778 gactatatcggcattcac 32444761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 5590797 - 5591007
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  5590797 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 5590891  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  5590892 tttcgatccaccgggaaacgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 5590991  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5590992 ctatatcggcattcac 5591007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 10648895 - 10648683
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  10648895 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 10648799  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  10648798 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 10648699  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  10648698 ctatatcggcattcac 10648683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 18057084 - 18056872
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           ||| |||||||||||||||| |||||||||||||    
T  18057084 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttttt--gtcacttatttttgcctggaccgccctttcgggt 18056988  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18056987 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18056888  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  18056887 ctatatcagcattcac 18056872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 18336452 - 18336240
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| || ||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  18336452 gagacgctcattcttgcctgagttgcgtgcactctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 18336356  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18336355 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgagttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18336256  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18336255 ctatatcggcattcac 18336240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 20071859 - 20071650
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  20071859 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 20071766  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  20071765 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 20071666  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  20071665 ctatatcggcattcac 20071650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 21680525 - 21680313
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| || |||||          |||||||||||||||||||| |||||||||||||    
T  21680525 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-cacatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 21680429  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  21680428 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 21680329  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  21680328 ctatatcggcattcac 21680313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 22382015 - 22382228
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||    
T  22382015 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatttttttgtg-tcccttatttttgcctggaccgccctttcgggt 22382112  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||    
T  22382113 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgttgttcttttcatatttctaggcaaagtatttcttga 22382212  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  22382213 ctatatcggcattcac 22382228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 4422743 - 4422525
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggt----cccttatttttgcctggatcgccctttc 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||           |    |||||||||||||||||| |||||||||    
T  4422743 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttttttttttatcccttatttttgcctggaccgccctttc 4422645  T
Q  186 gggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttc 285  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||    
T  4422644 gggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttc 4422545  T
Q  286 ttgactatatcagcattcac 305  Q
    ||||||||||| ||||||||    
T  4422544 ttgactatatcggcattcac 4422525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 10401973 - 10401754
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-----gtcccttatttttgcctggatcgcccttt 184  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||               |||||||||||||||||||| ||||||||    
T  10401973 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttttttttgtcccttatttttgcctggaccgcccttt 10401875  T
Q  185 cgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtattt 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||    
T  10401874 cgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtattt 10401775  T
Q  285 cttgactatatcagcattcac 305  Q
    |||||||||||| ||||||||    
T  10401774 cttgactatatcggcattcac 10401754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 32296453 - 32296238
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||    
T  32296453 gagacgctcattcttgcctgagttgtgtataatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcggg 32296355  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||    
T  32296354 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcaacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 32296255  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  32296254 actatatcggcattcac 32296238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 6207724 - 6207514
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  6207724 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggt 6207630  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||    
T  6207629 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatgtttctaggcaaagtatttcttga 6207530  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  6207529 ctatatcggcattcac 6207514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 6537179 - 6537391
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  6537179 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 6537275  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  6537276 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcggcttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 6537375  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  6537376 ctatatcggcattcac 6537391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 11104798 - 11105009
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||| || |           |||||||||||| ||||||| |||||||||||||    
T  11104798 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcaaatattttttttt---gtcccttatttt-gcctggaccgccctttcgggt 11104893  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  11104894 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 11104993  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  11104994 ctatatcggcattcac 11105009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 17979389 - 17979599
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  17979389 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggt 17979483  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  17979484 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 17979583  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  17979584 ctatatcggcattcac 17979599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 18286790 - 18287003
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||| ||||||||||||||||||| || |||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  18286790 gagacactcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 18286887  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||    
T  18286888 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccatgctgttcttttcatatttctaggcaaagtatttcttga 18286987  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18286988 ctatatcggcattcac 18287003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 18302091 - 18302304
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||| ||||||||||||||||||| || |||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  18302091 gagacactcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 18302188  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||    
T  18302189 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccatgctgttcttttcatatttctaggcaaagtatttcttga 18302288  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18302289 ctatatcggcattcac 18302304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 28344995 - 28344786
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  28344995 gagacactcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttt-----gtcccttatttttgcctggaccgccctttcgggt 28344902  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||    
T  28344901 tttcgatccaccaggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttga 28344802  T
Q  290 ctatatcagcattcac 305  Q
    |||||||  |||||||    
T  28344801 ctatatcgacattcac 28344786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 4727457 - 4727240
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatt--tgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgg 187  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||   |           |||||||||||||||||||| |||||||||||    
T  4727457 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatagatatattttttttgtcccttatttttgcctggaccgccctttcgg 4727358  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||| |||||||||||    
T  4727357 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcaggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttctt 4727258  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  4727257 gactatatcggcattcac 4727240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 94 - 305
Target Start/End: Original strand, 4791074 - 4791285
Alignment:
Q  94 cgctcattcttgcctgagttgcgtacaatctcagcgagctttttc---atatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggtt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||    ||||||           |||||||||||||||||||| ||||||||||||||    
T  4791074 cgctcattcttgcctgagttgcgtacaatctcagcgagcttttttcaaatatttttttttgt---gtcccttatttttgcctggaccgccctttcgggtt 4791170  T
Q  191 ttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgac 290  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||    
T  4791171 ttcgatccaccgggaagcgcatttttgcctaggctgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgac 4791270  T
Q  291 tatatcagcattcac 305  Q
    |||||| ||||||||    
T  4791271 tatatcggcattcac 4791285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 305
Target Start/End: Complemental strand, 24333922 - 24333773
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24333922 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 24333823  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  24333822 ttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 24333773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 305
Target Start/End: Complemental strand, 28027040 - 28026891
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28027040 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 28026941  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  28026940 ttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 28026891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 15735531 - 15735744
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||| || ||||| ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||    
T  15735531 gagacgctcattcttgtctaagttgtgtacaatctcagcgagctttt-catatatatttttttttg-tcccttatttttgcctggaccgccctttcgggt 15735628  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  15735629 tttcgatccaccgggaagcgcatttttacctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 15735728  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  15735729 ctatatcggcattcac 15735744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 156 - 305
Target Start/End: Complemental strand, 7078965 - 7078816
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7078965 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 7078866  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||||| | ||||| ||||||||| |||||||||| ||||||||    
T  7078865 ttcttttcatatttttaggcaaagtatttcctgactatatcggcattcac 7078816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 11922890 - 11923035
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  11922890 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 11922989  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  11922990 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 11923035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 22962181 - 22962036
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  22962181 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 22962082  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  22962081 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 22962036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 6574084 - 6573937
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgtt-ctt 260  Q
    |||||||||||||||||||||||||||||||||||||||  || || ||||||| |  || |||||||||||||||||||||||||||  |||||| |||    
T  6574084 atttttgcctggatcgccctttcgggttttcgatccaccaagacgctcatttttggtttaagccgccctttcgggttttcgacctaccgagctgttcctt 6573985  T
Q  261 ttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  6573984 tatatatatttagacaaagtatttcttgactgcatcagaattcacagg 6573937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 7086577 - 7086721
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  7086577 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 7086676  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
      |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  7086677 --atatatttagacaaagtatttcttgactgcatcagaattcacagg 7086721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 27561342 - 27561489
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  27561342 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 27561441  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | |||| ||| | |||||||||||||||  ||||| ||| |||||    
T  27561442 tatacatatttagacaaagtatttcttgactgcatcagaatttacagg 27561489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 17931223 - 17931137
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||||||||| ||||||||||||||||  |||||| ||| || |||||||||||| ||||||||||||||||||||||    
T  17931223 ccctaatttttgcctggattgccctttcgggttttcagtccaccaggatgctcatttttgcctaagccgccctttcgggttttcgac 17931137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 261
Target Start/End: Original strand, 37258241 - 37258340
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  37258241 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 37258340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 163 - 291
Target Start/End: Complemental strand, 46383064 - 46382934
Alignment:
Q  163 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||| ||||||||| |||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  46383064 atttttgcctggaccgcccttttcgggttttcaatccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 46382965  T
Q  261 ttcatatatctaggcgaagtatttcttgact 291  Q
    || | || | ||| | |||||||||||||||    
T  46382964 ttaaaatttttagacaaagtatttcttgact 46382934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 25268999 - 25268912
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  25268999 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 25268912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 163 - 291
Target Start/End: Complemental strand, 15707203 - 15707073
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgtt-ctt 260  Q
    ||||||||||||| |||||||||||||||||   |||||| || || ||||||||  | | |||||||||||||||||||||||||||  |||||| |||    
T  15707203 atttttgcctggaccgccctttcgggttttcagcccaccgagacgctcatttttggtttaagccgccctttcgggttttcgacctaccgagctgttcctt 15707104  T
Q  261 ttcatatatctaggcgaagtatttcttgact 291  Q
    |  |||| ||||| | |||||||||||||||    
T  15707103 tatatatgtctagacaaagtatttcttgact 15707073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 8609948 - 8609867
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  8609948 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 8609867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 306
Target Start/End: Original strand, 18904732 - 18904877
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |  |||||||||||||| |||||| ||||||||  ||||||||||    
T  18904732 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcaggtttttgacctaccgagctgttcttt 18904831  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcaca 306  Q
    |  | |||| ||| | || ||||||||||||  ||||| |||||||    
T  18904832 tatacatatttagacaaaatatttcttgactgcatcagaattcaca 18904877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 4453127 - 4453051
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || |||||||||||||| |||||| |||| || | |||||||||| |||||||||||||||||||    
T  4453127 ttttgcctggaccgtcctttcgggttttcaatccactgggacgctcttttttgcctaagccgccctttcgggttttc 4453051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 4452505 - 4452358
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    |||||||| |||| |||||||||||||||||  ||||||| || || ||||||| |  |||||| ||||||| | |||||||||||||  ||||||||||    
T  4452505 atttttgcttggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccaccctttcagattttcgacctaccgagctgttcttt 4452406  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | |||| ||| | |||||||||||||||  ||||| |||||||||    
T  4452405 tataaatatttagacaaagtatttcttgactgcatcagaattcacagg 4452358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 308
Target Start/End: Original strand, 6960964 - 6961110
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt-c 263  Q
    |||||| |||| |||| ||||||||||||  |||| || || || | ||||||  |||| |||||| ||||||||||||||||||  ||||||||||| |    
T  6960964 ttttgcatggaccgccttttcgggttttcagtccatcgagacgctcttttttgtttaggacgccctatcgggttttcgacctaccgagctgttcttttac 6961063  T
Q  264 a--tatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  ||||||||| | |||||||||||||||  ||||| |||||||||    
T  6961064 atgtatatctagacaaagtatttcttgactgcatcagaattcacagg 6961110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 10717369 - 10717456
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  10717369 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 10717456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 30091454 - 30091537
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  30091454 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 30091537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 5603083 - 5603161
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  5603083 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 5603161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 291
Target Start/End: Original strand, 5948332 - 5948462
Alignment:
Q  163 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  5948332 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 5948431  T
Q  261 ttcatatatctaggcgaagtatttcttgact 291  Q
    || |  | | ||| | |||||||||||||||    
T  5948432 ttaaagtttttagacaaagtatttcttgact 5948462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 8218126 - 8218048
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  8218126 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 8218048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 10402638 - 10402560
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  10402638 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 10402560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 22864618 - 22864696
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| |||||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22864618 atttttgcctgaactgccctttcgggttgtcgatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22864696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 22879677 - 22879755
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| |||||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22879677 atttttgcctgaactgccctttcgggttgtcgatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22879755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 90 - 144
Target Start/End: Complemental strand, 28027115 - 28027062
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatattt 144  Q
    ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||    
T  28027115 gagacgctcattcttgcctgagttgtgtacaatctcagcgagc-ttttcatattt 28027062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28027779 - 28027701
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28027779 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28027701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28345660 - 28345582
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28345660 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28345582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 31958225 - 31958303
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31958225 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31958303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 71886 - 71805
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  71886 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 71805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 4340380 - 4340421
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  4340380 atttttgcctggatcgccctttcgggttttcgatccaccggg 4340421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4690201 - 4690160
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  4690201 atttttgcctggatcgccctttcgggttttcgatccaccggg 4690160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5473543 - 5473502
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5473543 atttttgcctggatcgccctttcgggttttcgatccaccggg 5473502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 5590061 - 5590102
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5590061 atttttgcctggatcgccctttcgggttttcgatccaccggg 5590102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 5603017 - 5603058
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5603017 atttttgcctggatcgccctttcgggttttcgatccaccggg 5603058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5658687 - 5658646
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5658687 atttttgcctggatcgccctttcgggttttcgatccaccggg 5658646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5717625 - 5717584
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5717625 atttttgcctggatcgccctttcgggttttcgatccaccggg 5717584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5728535 - 5728494
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5728535 atttttgcctggatcgccctttcgggttttcgatccaccggg 5728494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 5763833 - 5763874
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5763833 atttttgcctggatcgccctttcgggttttcgatccaccggg 5763874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 6208450 - 6208409
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  6208450 atttttgcctggatcgccctttcgggttttcgatccaccggg 6208409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 7079783 - 7079742
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  7079783 atttttgcctggatcgccctttcgggttttcgatccaccggg 7079742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 8218192 - 8218151
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  8218192 atttttgcctggatcgccctttcgggttttcgatccaccggg 8218151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 10402704 - 10402663
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10402704 atttttgcctggatcgccctttcgggttttcgatccaccggg 10402663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 11104066 - 11104107
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  11104066 atttttgcctggatcgccctttcgggttttcgatccaccggg 11104107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 291
Target Start/End: Original strand, 15581640 - 15581768
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc--ctttcgggttttcgacctaccacgctgttctttt 262  Q
    ||||||||||| |||||||||||||||||  ||||||| || ||  ||||||||||| ||||||  |||| ||||||||||| ||||  ||||||||| |    
T  15581640 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctaatttttgcctaagccgccctcttttgggttttcgacttaccgagctgttcttgt 15581739  T
Q  263 catatatctaggcgaagtatttcttgact 291  Q
     | || | ||| | |||||||||||||||    
T  15581740 aagatttttagacaaagtatttcttgact 15581768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15734817 - 15734858
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15734817 atttttgcctggatcgccctttcgggttttcgatccaccggg 15734858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15886445 - 15886486
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15886445 atttttgcctggatcgccctttcgggttttcgatccaccggg 15886486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 16422740 - 16422699
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16422740 atttttgcctggatcgccctttcgggttttcgatccaccggg 16422699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 16618207 - 16618248
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16618207 atttttgcctggatcgccctttcgggttttcgatccaccggg 16618248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 17970570 - 17970611
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  17970570 atttttgcctggatcgccctttcgggttttcgatccaccggg 17970611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 17978652 - 17978693
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  17978652 atttttgcctggatcgccctttcgggttttcgatccaccggg 17978693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 18231683 - 18231602
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  18231683 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 18231602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 18231749 - 18231708
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18231749 atttttgcctggatcgccctttcgggttttcgatccaccggg 18231708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 18249293 - 18249252
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18249293 atttttgcctggatcgccctttcgggttttcgatccaccggg 18249252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 18286125 - 18286206
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  18286125 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 18286206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 18301426 - 18301507
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  18301426 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 18301507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 18337179 - 18337138
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18337179 atttttgcctggatcgccctttcgggttttcgatccaccggg 18337138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 20570552 - 20570593
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20570552 atttttgcctggatcgccctttcgggttttcgatccaccggg 20570593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 21681256 - 21681215
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  21681256 atttttgcctggatcgccctttcgggttttcgatccaccggg 21681215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22864552 - 22864593
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22864552 atttttgcctggatcgccctttcgggttttcgatccaccggg 22864593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22879611 - 22879652
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22879611 atttttgcctggatcgccctttcgggttttcgatccaccggg 22879652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 24334731 - 24334690
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24334731 atttttgcctggatcgccctttcgggttttcgatccaccggg 24334690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 28027845 - 28027804
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28027845 atttttgcctggatcgccctttcgggttttcgatccaccggg 28027804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 29142458 - 29142499
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29142458 atttttgcctggatcgccctttcgggttttcgatccaccggg 29142499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 29658672 - 29658713
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  29658672 atttttgcctggatcgccctttcgggttttcgatccaccggg 29658713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31958159 - 31958200
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31958159 atttttgcctggatcgccctttcgggttttcgatccaccggg 31958200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 35887316 - 35887275
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  35887316 atttttgcctggatcgccctttcgggttttcgatccaccggg 35887275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 47030010 - 47029969
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  47030010 atttttgcctggatcgccctttcgggttttcgatccaccggg 47029969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 48472487 - 48472446
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  48472487 atttttgcctggatcgccctttcgggttttcgatccaccggg 48472446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 244
Target Start/End: Original strand, 3240297 - 3240385
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||| ||||||||||||| |||  |||||||||||   |||||||||| || ||||||||| || |||||||||| |||||||||||    
T  3240297 gtccctaatttttgcctggaccgcgatttcgggtttttagtccaccgggacgctcatttttgcttaagccgcccttttgggttttcgac 3240385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 90 - 145
Target Start/End: Complemental strand, 7079048 - 7078994
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttg 145  Q
    |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||    
T  7079048 gagacgcttattcttgcctgagttgtgtacaatctcagcgagc-ttttcatatttg 7078994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 15532445 - 15532524
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  15532445 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 15532524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 291
Target Start/End: Complemental strand, 15921219 - 15921089
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc--ctttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||  |||| || |||||||| ||||  |||||||||    
T  15921219 atttttgcctggaccgccctttcgggttttcagtccaccgagatgctcatttttgcctaagtcgccctcttttggattttcgacttaccgagctgttctt 15921120  T
Q  261 ttcatatatctaggcgaagtatttcttgact 291  Q
     | | || | ||| | |||||||||||||||    
T  15921119 gtaagatttttagacaaagtatttcttgact 15921089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 23283719 - 23283802
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| | |||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  23283719 ccctaatttttgcctggaccaccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 23283802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 244
Target Start/End: Complemental strand, 3681471 - 3681389
Alignment:
Q  162 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||||||||| |||||||||||||||||   |||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  3681471 tatttttgcctggaccgccctttcgggttttcagaccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 3681389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 4340446 - 4340524
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4340446 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4340524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4630274 - 4630196
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4630274 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4630196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5020202 - 5020124
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  5020202 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 5020124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5473477 - 5473399
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  5473477 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 5473399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 6208387 - 6208309
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  6208387 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 6208309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 8283228 - 8283306
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  8283228 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 8283306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 10649561 - 10649483
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  10649561 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 10649483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 18249227 - 18249149
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| |  ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  18249227 atttttgcctgaattgccctttcgggttattaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 18249149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 21681190 - 21681112
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  21681190 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 21681112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 22381351 - 22381429
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22381351 atttttgcctgaactgccctttcgggttgtcaatccaacggggtgctcatttttgcctaagccgccctttcgggttttc 22381429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 24334665 - 24334587
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||| ||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  24334665 atttttgcctgaactgccccttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 24334587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 29142524 - 29142602
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||| || |||||||||||| ||||||||| |||||||||    
T  29142524 atttttgcctgaactgccctttcgggttgtcaatccagcgggatgctcatttttgcctaagccgcccttccgggttttc 29142602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 29658738 - 29658816
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  29658738 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 29658816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 244
Target Start/End: Complemental strand, 30018027 - 30017945
Alignment:
Q  162 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||||||||| |||||||||||||||||   |||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  30018027 tatttttgcctggaccgccctttcgggttttcagaccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 30017945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 48472421 - 48472343
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  48472421 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 48472343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 51788511 - 51788433
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  51788511 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 51788433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 3408762 - 3408681
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||| || |||| ||||| ||||    
T  3408762 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccaccttttcaggtttgcgac 3408681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4423474 - 4423433
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  4423474 atttttgcctagatcgccctttcgggttttcgatccaccggg 4423433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4630340 - 4630299
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  4630340 atttttgcttggatcgccctttcgggttttcgatccaccggg 4630299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 4728181 - 4728140
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||| |||||||||||||||||||||||||||||||||||    
T  4728181 atttttacctggatcgccctttcgggttttcgatccaccggg 4728140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 4790337 - 4790378
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  4790337 atttttgcctggatcgccctttcgggttttcaatccaccggg 4790378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5020268 - 5020227
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  5020268 atttttgcctggatcgccctttcgggttttcggtccaccggg 5020227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 8283162 - 8283203
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  8283162 atttttgcctggatcgccctttcgggttttcgatccatcggg 8283203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 10649627 - 10649586
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  10649627 atttttgcctggatcgccctttcgggttttcggtccaccggg 10649586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 245
Target Start/End: Complemental strand, 15707884 - 15707801
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt---gcctaggccgccctttcgggttttcgacc 245  Q
    ||||||||||| ||||||||||||||||||||||| ||||  || | |||||   |  ||||||||||||||||||||||||||    
T  15707884 ttttgcctggaccgccctttcgggttttcgatccatcggggcgctcctttttttggtttaggccgccctttcgggttttcgacc 15707801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 308
Target Start/End: Original strand, 17437928 - 17438012
Alignment:
Q  223 gccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    ||||||||||| |||||||||||||||  ||||||||||| |||||| ||| | |||||||||||||||  ||||  |||||||||    
T  17437928 gccgccctttcaggttttcgacctaccgagctgttctttt-atatatttagacaaagtatttcttgactgcatcataattcacagg 17438012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 18286059 - 18286100
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  18286059 atttttgcctggatcgccctttcgggttttcgacccaccggg 18286100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 18301360 - 18301401
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  18301360 atttttgcctggatcgccctttcgggttttcgacccaccggg 18301401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 20072591 - 20072550
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  20072591 atttttgcctggatcgccctttcgggttttcgacccaccggg 20072550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22381285 - 22381326
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||| |||||||||||||||||||    
T  22381285 atttttgcctggatcgcccttttgggttttcgatccaccggg 22381326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 28109655 - 28109696
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  28109655 atttttgcctggatcgccctttcgggttttcaatccaccggg 28109696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 28345726 - 28345685
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||| ||||||||||||||||||||    
T  28345726 atttttgcctggatcgcccttccgggttttcgatccaccggg 28345685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31029948 - 31029989
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  31029948 atttttgcctggatcgccctttcgggttttcgacccaccggg 31029989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 200
Target Start/End: Complemental strand, 32297186 - 32297149
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccac 200  Q
    ||||||||||||||||||||||||||||||||||||||    
T  32297186 atttttgcctggatcgccctttcgggttttcgatccac 32297149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 32445705 - 32445664
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||| ||||||||||||||||||||||||||||||||||    
T  32445705 atttttgtctggatcgccctttcgggttttcgatccaccggg 32445664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 51788577 - 51788536
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  51788577 atttttgcctggatcgccctttcgggttttcgacccaccggg 51788536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 72614 - 72530
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || || |||||||||| |||||| |||| |||||||    
T  72614 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcattttttgcctaagccgccttttcaggttttc 72530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 6536447 - 6536487
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgg 203  Q
    |||||||||||||||||||||||| ||||||||||||||||    
T  6536447 atttttgcctggatcgccctttcgagttttcgatccaccgg 6536487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 15580893 - 15580933
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||||||||||||||    
T  15580893 ttttgcctggaccgccctttcgggttttcgatccaccggga 15580933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 260
Target Start/End: Complemental strand, 20445830 - 20445746
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  20445830 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 20445746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 15624618 - 15624539
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  | ||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  15624618 ttttgcctggaccgccctttcgggttttcagttcaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 15624539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 90 - 145
Target Start/End: Complemental strand, 24333997 - 24333943
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttg 145  Q
    |||||||||||||||||||||||||  |||||||||||||||| ||||||| ||||    
T  24333997 gagacgctcattcttgcctgagttgtatacaatctcagcgagc-ttttcatttttg 24333943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 41003773 - 41003686
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||| ||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  41003773 ccctaatttttgcctggaccgccttttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 41003686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 41012554 - 41012467
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||| ||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  41012554 ccctaatttttgcctggaccgccttttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 41012467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4423408 - 4423330
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  4423408 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 4423330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4728118 - 4728040
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  4728118 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 4728040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 4790403 - 4790481
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  4790403 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 4790481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 5590127 - 5590205
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5590127 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5590205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5717559 - 5717481
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5717559 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5717481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5728469 - 5728391
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5728469 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5728391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 5763899 - 5763977
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  5763899 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 5763977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 6536513 - 6536591
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  6536513 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 6536591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 7079717 - 7079639
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||| |||||||||||||||    
T  7079717 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccaccctttcgggttttc 7079639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 11104132 - 11104210
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||| |||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11104132 atttttgcctgaactgccctttcaggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11104210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 15886511 - 15886589
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  15886511 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 15886589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 17970636 - 17970714
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  17970636 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 17970714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 17978718 - 17978796
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||| ||||||||||||||    
T  17978718 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgtcctttcgggttttc 17978796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 18057819 - 18057781
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||| ||||||||||||||||||||||||||||||||    
T  18057819 attttttcctggatcgccctttcgggttttcgatccacc 18057781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 18337112 - 18337034
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  18337112 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 18337034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 20072525 - 20072447
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  20072525 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 20072447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 233
Target Start/End: Original strand, 23284455 - 23284525
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 233  Q
    |||||||||| || |||||||||||||||||  ||||||| || || |||||||||||| |||||| ||||    
T  23284455 atttttgcctagaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttc 23284525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 31030014 - 31030092
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||  | ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31030014 atttttgcctgaactgccctttcgggttgccaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31030092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 32445639 - 32445561
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  32445639 atttttgcctgaactgccctttcgggttgtcaatccagcgggttgctcatttttgcctaagtcgccctttcgggttttc 32445561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 47029944 - 47029866
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  47029944 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 47029866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 5947566 - 5947615
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  5947566 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 5947615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 6200136 - 6200087
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  6200136 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 6200087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 8200259 - 8200347
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt--gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||  || || ||| ||||| ||||||||||||    
T  8200259 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcattttttggcttaagccacccttccgggttttcgac 8200347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 8810220 - 8810171
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  8810220 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 8810171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 10717305 - 10717346
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  10717305 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 10717346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 228
Target Start/End: Original strand, 12475407 - 12475472
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    |||||||||| || |||||||||||||||||  ||||||| || || |||||||||||| ||||||    
T  12475407 atttttgcctagaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcc 12475472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 14661917 - 14661958
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||||||||||||||||||||| ||||| ||||||    
T  14661917 ttttgcctggatcgccctttcgggttttcaatccatcgggaa 14661958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 25269063 - 25269022
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  25269063 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 25269022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 27560673 - 27560752
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc---atttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |||||||| |||||||| ||||||||||| || |    |||||||||| | |||||||||||||||||    
T  27560673 ttttgcctggaccgcccttttgggttttcaatccaccgggatgctctctttttttgcctaagtcgccctttcgggttttc 27560752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 228
Target Start/End: Original strand, 30092174 - 30092239
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| ||||||    
T  30092174 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgcc 30092239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 240
Target Start/End: Complemental strand, 32297120 - 32297043
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtttt 240  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||    
T  32297120 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggtttt 32297043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 46383839 - 46383790
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  46383839 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 46383790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 46395056 - 46395105
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  46395056 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 46395105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 7085888 - 7085928
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||||||||||||| |||||||| |||||||||||||||||    
T  7085888 ttttgcctggatcgtcctttcggattttcgatccaccggga 7085928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 18904132 - 18904207
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| |||||| |||||||| |||||||| |||||| |||| || | |||| ||||| |||||||||||||||||||    
T  18904132 tttttcctggaccgcccttttgggttttcaatccactgggatgctcctttt-gcctaagccgccctttcgggttttc 18904207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 3682177 - 3682130
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  3682177 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 3682130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 5947631 - 5947678
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  5947631 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 5947678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 6200069 - 6200022
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  6200069 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 6200022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 8622082 - 8622035
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  8622082 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 8622035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 13107374 - 13107421
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  13107374 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 13107421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 13108106 - 13108185
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| | |||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  13108106 ttttgcctggaccacccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 13108185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 15531757 - 15531804
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  15531757 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 15531804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 15580953 - 15581000
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  15580953 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 15581000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 15921897 - 15921850
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| |||||||||||| ||||||||||||||||||  ||||||||||    
T  15921897 ccctaatttttgcctgggtcgccctttcgggttttcagtccaccggga 15921850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 201
Target Start/End: Complemental strand, 22962827 - 22962784
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||| ||||||||||||||||||||||||||||    
T  22962827 ccctaatttttacctagatcgccctttcgggttttcgatccacc 22962784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 30018736 - 30018689
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  30018736 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 30018689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 46383774 - 46383727
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  46383774 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 46383727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4690135 - 4690057
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  4690135 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 4690057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5658621 - 5658543
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||  ||||||||    
T  5658621 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttctgggttttc 5658543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Original strand, 11922203 - 11922245
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  11922203 ccctaatttttacctggaccgccctttcgggttttcgatccac 11922245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 15734883 - 15734961
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||  ||||||||    
T  15734883 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttctgggttttc 15734961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 16422674 - 16422596
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||| |||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  16422674 atttttgcctgaactgccctttcaggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 16422596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 28109721 - 28109799
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||| | || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  28109721 atttttgcctgaactgccctttcggggtgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 28109799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 35887250 - 35887172
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||| || ||||||||||||| |||||    
T  35887250 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcgtaagccgccctttcggattttc 35887172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #228
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 72682 - 72641
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  72682 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 72641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #229
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 266338 - 266301
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttc 193  Q
    |||||| ||||||||||||| |||||||||||||||||    
T  266338 gtccctaatttttgcctggaccgccctttcgggttttc 266301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #230
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 200
Target Start/End: Original strand, 7085960 - 7085997
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||||| |||||||| ||||||||||||||||||||||    
T  7085960 atttttacctggatcaccctttcgggttttcgatccac 7085997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #231
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 8622139 - 8622098
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  8622139 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 8622098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #232
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 12573696 - 12573655
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  12573696 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 12573655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #233
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 13550160 - 13550119
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  13550160 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 13550119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #234
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15531697 - 15531738
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  15531697 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 15531738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #235
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 21613684 - 21613643
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  21613684 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 21613643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #236
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 37257511 - 37257552
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  37257511 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 37257552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #237
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 41003835 - 41003794
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  41003835 ttttacctggaccgccctttcgggttttcaatccaccgggaa 41003794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #238
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 41012616 - 41012575
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  41012616 ttttacctggaccgccctttcgggttttcaatccaccgggaa 41012575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #239
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 8810148 - 8810108
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  8810148 ttttgcctggaccgccctttcgggttttcagtccaccggga 8810108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #240
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 12553974 - 12553910
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 227  Q
    |||||||| |||| ||||||||| |||||||  ||||||| || || |||||||||||| |||||    
T  12553974 atttttgcttggaccgccctttctggttttcagtccaccgagacgctcatttttgcctaagccgc 12553910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #241
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 15679776 - 15679824
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||| | |||||||||||||| |||||||| |||| |||||||||||    
T  15679776 gtccctaacttttgcctggatcgtcctttcggattttggatccaccggg 15679824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #242
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 15921956 - 15921916
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||| |||| |||||    
T  15921956 ttttgcctggaccgccctttcgggttttcggtccatcggga 15921916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 56)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 16202426 - 16202644
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||| |    
T  16202426 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggatcgccctttcggct 16202525  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||    
T  16202526 ttttgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgatgttcttttcatatatctaggcaaagtatttcttga 16202625  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  16202626 ctatatcagcattcacagg 16202644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 3647009 - 3646794
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||| |||||||| |||||||||||||    
T  3647009 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttctgcctggaccgccctttcgggt 3646910  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  3646909 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 3646810  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  3646809 ctatatcggcattcac 3646794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 20334809 - 20335026
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  20334809 gagacgctcatttttgcctgagttgcatacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 20334907  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||    
T  20334908 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacactgttcttttcatatatctaggcaaagtatttcttga 20335007  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  20335008 ctatatcagcattcacagg 20335026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 10968528 - 10968316
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  10968528 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 10968432  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  10968431 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 10968332  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  10968331 ctatatcagcattcac 10968316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 41787704 - 41787917
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  41787704 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 41787801  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  41787802 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 41787901  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  41787902 ctatatcggcattcac 41787917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 51644083 - 51643869
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  51644083 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 51643985  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  51643984 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 51643885  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  51643884 ctatatcggcattcac 51643869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 20466642 - 20466428
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||   |||||           ||||||||||||| ||||||||||||||||||||    
T  20466642 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttcattattttttttttt---gtcccttattttt-cctggatcgccctttcgggt 20466547  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||    
T  20466546 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatatctaggcaaagtatttcttga 20466447  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  20466446 ctatatcagcattcacagg 20466428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 28590946 - 28590732
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  28590946 gagacgctcattcttgcctgatttgcgtacaatctcagcgagctttt-catatattttttttttttgtcccttatttttgcctggaccgccctttcgggt 28590848  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  28590847 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 28590748  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  28590747 ctatatcggcattcac 28590732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 28155597 - 28155388
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  28155597 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 28155504  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  28155503 tttcgatccaccgggaagcgcatttttgcctgggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 28155404  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  28155403 ctatatcggcattcac 28155388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 305
Target Start/End: Complemental strand, 10950877 - 10950728
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10950877 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 10950778  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||||| ||||||| ||||||||||||||||||||||| |||||    
T  10950777 ttcttttcatatttctaggcaaagtatttcttgactatatcagcgttcac 10950728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 21892141 - 21892354
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt--tcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgcccttt- 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  | || ||||            ||||||||||||| |||||| ||||||||     
T  21892141 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttcattatttttgttttttttttttgtcccttattttt-cctggaccgccctttt 21892239  T
Q  185 cgggttttcgatccaccgggaagcgcattttt-gcctaggccgcccttt-cgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtat 282  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||        |||    
T  21892240 cgggttttcgatccaccgggaagcgcattttttgcctaggccgcccttttcgggttttcgacctaccacgctgttcttttcatatttct--------tat 21892331  T
Q  283 ttcttgactatatcagcattcac 305  Q
    |||||||||||||| ||||||||    
T  21892332 ttcttgactatatcggcattcac 21892354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 163 - 258
Target Start/End: Complemental strand, 22491814 - 22491718
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgacctaccacgctgttc 258  Q
    ||||||||||||| |||||||||||||||||||||||||| || || || ||||||  || |||||||||| ||||||||||||||||  |||||||    
T  22491814 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcattttttgtttaagccgcccttttgggttttcgacctaccgagctgttc 22491718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 13456547 - 13456400
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || ||||||||  | ||||||||||||||||||||| |||||||  ||||||||||    
T  13456547 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 13456448  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  13456447 tataaaaatttagacaaagtatttcttgactgcatcagaattcacagg 13456400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 13469144 - 13469057
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| | ||||||||||||||| ||||||||||| || ||||||| || || ||||||||||||||||||||||    
T  13469144 ccctaatttttgcctggacctccctttcgggttttcaatccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 13469057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 163 - 291
Target Start/End: Original strand, 5626485 - 5626615
Alignment:
Q  163 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | |||||||| |||||||||||| ||||  |||||||||    
T  5626485 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 5626584  T
Q  261 ttcatatatctaggcgaagtatttcttgact 291  Q
    || | || | ||| | |||||||||||||||    
T  5626585 ttaaaatttttagacaaagtatttcttgact 5626615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 13457181 - 13457105
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| ||||||||||||||||| ||||||||||| || | |||||||| | |||||||||| ||||||||    
T  13457181 ttttgcctggaccgccctttcgggttttcaatccaccgggacgctcttttttgccaaagccgcccttttgggttttc 13457105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 31557543 - 31557456
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  31557543 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 31557456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 3647742 - 3647701
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  3647742 atttttgcctggatcgccctttcgggttttcgatccaccggg 3647701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 10951687 - 10951646
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10951687 atttttgcctggatcgccctttcgggttttcgatccaccggg 10951646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 16201696 - 16201737
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16201696 atttttgcctggatcgccctttcgggttttcgatccaccggg 16201737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 20334076 - 20334117
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20334076 atttttgcctggatcgccctttcgggttttcgatccaccggg 20334117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 20467381 - 20467340
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20467381 atttttgcctggatcgccctttcgggttttcgatccaccggg 20467340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 28591676 - 28591635
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28591676 atttttgcctggatcgccctttcgggttttcgatccaccggg 28591635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 41786970 - 41787011
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  41786970 atttttgcctggatcgccctttcgggttttcgatccaccggg 41787011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 51644817 - 51644776
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  51644817 atttttgcctggatcgccctttcgggttttcgatccaccggg 51644776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 90 - 145
Target Start/End: Complemental strand, 10950954 - 10950900
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttg 145  Q
    |||||||||||||||||||||||||  |||||||||||||||| ||||||||||||    
T  10950954 gagacgctcattcttgcctgagttgtttacaatctcagcgagc-ttttcatatttg 10950900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 158 - 228
Target Start/End: Original strand, 2337741 - 2337811
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| ||||||    
T  2337741 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgcc 2337811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28156257 - 28156179
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  28156257 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 28156179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 41787036 - 41787114
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| | ||  || |||||||||||| |||||||||||||||||||    
T  41787036 atttttgcctgaattgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagccgccctttcgggttttc 41787114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 10969195 - 10969114
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| || ||||||||||||| || || || ||||  || | |||||||||| ||||||||||||||||||||||    
T  10969195 atttttgcctgaattgccctttcgggttgtcaattcagcggggtgctcttttttgcctaagccgccctttcgggttttcgac 10969114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 28156323 - 28156282
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  28156323 atttttgcctggatcgccctttcgggttttcgacccaccggg 28156282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 31545449 - 31545362
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||| ||||||||  |||||| ||| || || ||||||| || ||||||||||| ||||||||||    
T  31545449 ccctaatttttgcctggaccgcccttttgggttttcagtccaccaggacgctcattttttgcttaagccgccctttcaggttttcgac 31545362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 35073338 - 35073259
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  35073338 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 35073259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 3647676 - 3647598
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| || ||||||||| ||||||    
T  3647676 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagctgccctttcgtgttttc 3647598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 10951621 - 10951543
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  10951621 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 10951543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 21891419 - 21891457
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||||||||||||||||||||||| ||||    
T  21891419 atttttgcctggatcgccctttcgggttttcgattcacc 21891457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28591610 - 28591532
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  28591610 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 28591532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 51644751 - 51644673
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  51644751 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 51644673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 2338463 - 2338544
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  ||||||| |  || |||||||||| | |||||| |||| ||||| ||||    
T  2338463 atttttgcctggaccgccctttcgggttttcagtccaccgaggcgctcatttttgcccaagccgccttttcaggtttgcgac 2338544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 2390026 - 2389947
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagc---gcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||||||||||||||||||||  ||||||||||| ||      |||||||||| | |||||||||||||||||    
T  2390026 ttttgcctggatcgccctttcgggtttttaatccaccgggacgctttttttttttgcctaagtcgccctttcgggttttc 2389947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 5625727 - 5625776
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  5625727 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 5625776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 10969261 - 10969220
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||| | ||||||||||||||||||||||||||||    
T  10969261 atttttgcctgaaccgccctttcgggttttcgatccaccggg 10969220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 31557607 - 31557566
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  31557607 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 31557566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 5625793 - 5625840
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  5625793 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 5625840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 6199407 - 6199454
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  6199407 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 6199454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 260
Target Start/End: Complemental strand, 9297302 - 9297219
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 260  Q
    |||||||| |||||| |  ||||||| || || |||||||||||| ||| || |||| |||||||||||||||  |||||||||    
T  9297302 cgcccttttgggtttgcagtccaccgagacgctcatttttgcctaagcctccttttcaggttttcgacctaccgagctgttctt 9297219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 205
Target Start/End: Original strand, 14815457 - 14815499
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||||| |||||||||||||||||  ||||||||||    
T  14815457 atttttgcctggaccgccctttcgggttttcagtccaccggga 14815499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 20334142 - 20334220
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| | |||||||||||||||||    
T  20334142 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagtcgccctttcgggttttc 20334220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 20467315 - 20467237
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || || ||||||||| | |||||||||||||||||    
T  20467315 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcagttttgcctaagtcgccctttcgggttttc 20467237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 1959611 - 1959530
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||||| || |||||||||| ||||||  ||||||| || |  |||||||||||| |||||| |||| ||||| ||||    
T  1959611 atttttgcctagaccgccctttcgagttttcagtccaccgagacgttcatttttgcctaagccgccttttccggtttgcgac 1959530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 2337679 - 2337720
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  2337679 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 2337720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 14815384 - 14815433
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| | ||||||||||||||| |||||| |||||    
T  14815384 tccctaatttttgcctggacctccctttcgggttttcaatccacagggaa 14815433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 228
Target Start/End: Complemental strand, 19372964 - 19372899
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    ||||||||||||| |||||||||||||| ||  ||||||  || || |||||||||||| ||||||    
T  19372964 atttttgcctggaccgccctttcgggttgtcagtccaccaagacgctcatttttgcctaagccgcc 19372899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 31545511 - 31545470
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||| |||||| ||||||||||||||||| ||||||||||||    
T  31545511 ttttacctggaccgccctttcgggttttcaatccaccgggaa 31545470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 35074111 - 35074070
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  35074111 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 35074070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 21454647 - 21454687
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  21454647 ttttgcctggaccgccctttcgggttttcagtccaccggga 21454687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 159)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 2104440 - 2104655
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||    
T  2104440 gagacgcttattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttttgcctggatcgccctttcgggt 2104539  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  2104540 tttcgatccaccggaaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 2104639  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  2104640 ctatatcggcattcac 2104655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26664192 - 26664406
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  26664192 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggt 26664290  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  26664291 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 26664390  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  26664391 ctatatcagcattcac 26664406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26679384 - 26679598
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  26679384 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggt 26679482  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  26679483 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 26679582  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  26679583 ctatatcagcattcac 26679598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 5141614 - 5141832
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng---gtcccttatttttgcctggatcgccctttcg 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||| ||||||||||    
T  5141614 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgtttttttttttttgtcccttatttttgcctggaccgccctttcg 5141713  T
Q  187 ggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttct 286  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||    
T  5141714 ggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttct 5141813  T
Q  287 tgactatatcagcattcac 305  Q
    |||||||||| ||||||||    
T  5141814 tgactatatcggcattcac 5141832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 24586814 - 24587026
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  24586814 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 24586910  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||    
T  24586911 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttga 24587010  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  24587011 ctatatcggcattcac 24587026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 16047175 - 16046960
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          ||||||||||||||||| || |||||||||||||    
T  16047175 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctagaccgccctttcgggt 16047079  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |    
T  16047078 tttcgatccaccgggaagcggatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttta 16046979  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  16046978 ctatatcagcattcacagg 16046960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 16512713 - 16512925
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||| ||||    
T  16512713 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgcccttttgggt 16512806  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  16512807 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 16512906  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  16512907 ctatatcagcattcacagg 16512925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 2779110 - 2778900
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  2779110 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 2779016  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  2779015 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 2778916  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  2778915 ctatatcagcattcac 2778900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 4205247 - 4205035
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| ||||||||          ||||||||||||||||||||||||||||||||||    
T  4205247 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggatcgccctttcgggt 4205151  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||    
T  4205150 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttga 4205051  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  4205050 ctatatcggcattcac 4205035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 11446746 - 11446533
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  11446746 gagacgctcattcttgcctgagttgtgtataatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 11446649  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  11446648 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 11446549  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  11446548 ctatatcagcattcac 11446533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26269368 - 26269578
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  26269368 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 26269462  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  26269463 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 26269562  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26269563 ctatatcggcattcac 26269578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 45393076 - 45392866
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  45393076 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 45392982  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  45392981 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 45392882  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  45392881 ctatatcggcattcac 45392866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 16444282 - 16444501
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||            ||||||||||||| |||||| |||||||| ||    
T  16444282 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttttcatatttgtttttgttttttgtcccttattttt-cctggaccgcccttttgg 16444380  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16444381 gtttttgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttctt 16444480  T
Q  288 gactatatcagcattcacagg 308  Q
    |||||||||||||||||||||    
T  16444481 gactatatcagcattcacagg 16444501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 4139526 - 4139738
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  4139526 gagacgctcattcttgcctgagttgtgtataatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggt 4139622  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  4139623 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 4139722  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  4139723 ctatatcggcattcac 4139738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5164242 - 5164029
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  5164242 gagacgctcattcttgcctgagttgtgtacaatctcagcgcgctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 5164145  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5164144 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5164045  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5164044 ctatatcggcattcac 5164029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 11419058 - 11419271
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  11419058 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 11419155  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||    
T  11419156 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaaatatttcttga 11419255  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  11419256 ctatatcggcattcac 11419271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26314127 - 26314340
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  26314127 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttctttttg-tcccttatttttgcctggaccgccctttcgggt 26314224  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  26314225 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 26314324  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26314325 ctatatcggcattcac 26314340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 26518651 - 26518438
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  26518651 gagacgctcattcttgcctgagttgtgtataatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 26518554  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||    
T  26518553 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacactgttcttttcatatttctaggcaaagtatttcttga 26518454  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  26518453 ctatatcagcattcac 26518438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 31084902 - 31085114
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  31084902 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggt 31084998  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  31084999 tttcgatccaccgggaggcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 31085098  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31085099 ctatatcggcattcac 31085114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 31558672 - 31558882
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  31558672 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 31558766  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  31558767 tttcgatccaccgggaagcgaatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 31558866  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31558867 ctatatcggcattcac 31558882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 39207418 - 39207631
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  39207418 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 39207515  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  39207516 tttcgatccaccgggaagcgcatttttgcctagtccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 39207615  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  39207616 ctatatcggcattcac 39207631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26532149 - 26532365
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||            |||||||||||||||||||| |||||||||||    
T  26532149 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatgtgtgttttttttttgtcccttatttttgcctggaccgccctttcgg 26532247  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  26532248 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 26532347  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  26532348 gactatatcggcattcac 26532365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 112 - 308
Target Start/End: Complemental strand, 10847453 - 10847263
Alignment:
Q  112 ttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca 211  Q
    ||||||||||||||||||||||||||||||||||          |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
T  10847453 ttgcgtacaatctcagcgagctttttcatatttgttttt-----gtcccttatttt-gcctggatcgccctttcgagttttcgatccaccgggaagcgca 10847360  T
Q  212 tttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  10847359 tttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttgactatatcagcattcacagg 10847263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 2160429 - 2160220
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||| |||    
T  2160429 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcaggt 2160336  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  2160335 tttcgatccaccgggaagcgtatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 2160236  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  2160235 ctatatcggcattcac 2160220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 16732809 - 16733018
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  16732809 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 16732902  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  16732903 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 16733002  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  16733003 ctatatcggcattcac 16733018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 16745800 - 16746009
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  16745800 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 16745893  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  16745894 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 16745993  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  16745994 ctatatcggcattcac 16746009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 26441111 - 26440903
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  26441111 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatttttt------gtcccttatttttgcctggaccgccctttcgggt 26441019  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  26441018 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 26440919  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26440918 ctatatcggcattcac 26440903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 26509976 - 26510188
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  26509976 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 26510072  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||| |||||||||||||    
T  26510073 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttctcatttatttaggcaaagtatttcttga 26510172  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  26510173 ctatatcggcattcac 26510188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 91 - 305
Target Start/End: Complemental strand, 5153941 - 5153730
Alignment:
Q  91 agacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggtt 190  Q
    ||||||||||||||||||||||||||| ||| |||||||||||||||||||| |           |||||||||||||||||||| | ||||||||||||    
T  5153941 agacgctcattcttgcctgagttgcgtgcaacctcagcgagctttttcatatatattttttt---gtcccttatttttgcctggaccaccctttcgggtt 5153845  T
Q  191 ttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgac 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||    
T  5153844 ttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgac 5153745  T
Q  291 tatatcagcattcac 305  Q
    |||||| ||||||||    
T  5153744 tatatcggcattcac 5153730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 31129763 - 31129553
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  31129763 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 31129669  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  31129668 ttaccatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 31129569  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31129568 ctatatcggcattcac 31129553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 305
Target Start/End: Complemental strand, 3451101 - 3450952
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3451101 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 3451002  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  3451001 ttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 3450952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 45737161 - 45736953
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||| ||| ||||||| |||||||||||||    
T  45737161 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttacttt-gcctggaccgccctttcgggt 45737069  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  45737068 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 45736969  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  45736968 ctatatcggcattcac 45736953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 211 - 305
Target Start/End: Original strand, 10911267 - 10911361
Alignment:
Q  211 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  10911267 atttttgcctggaccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 10911361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 15195847 - 15195702
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||| ||||||||||    
T  15195847 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccaagctgttcttt 15195748  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  15195747 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 15195702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 2559299 - 2559154
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  2559299 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 2559200  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  2559199 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 2559154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 29092280 - 29092135
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| ||||||||||||||||||||||| || || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  29092280 atttttgcctggaccgccctttcgggttttcgatccatcgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 29092181  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  29092180 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 29092135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 16125215 - 16125360
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  16125215 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 16125314  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | || ||||||||||||  ||| | |||||||||    
T  16125315 t-atatatttagacaaaatatttcttgactgcatccgaattcacagg 16125360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 16240180 - 16240035
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| ||||||||||||||||||||||| || || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  16240180 atttttgcctggaccgccctttcgggttttcgatccatcgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 16240081  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||  | |||||||||||||||  ||||| |||||||||    
T  16240080 t-atatatttaaacaaagtatttcttgactgcatcagaattcacagg 16240035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 1890947 - 1891094
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |  |||||||||||||||||||||| |||||||  ||||||||||    
T  1890947 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 1891046  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  1891047 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 1891094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 261
Target Start/End: Complemental strand, 9472080 - 9471981
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  9472080 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 9471981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 10911199 - 10911299
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||           |||||||||||||||||||| |||||||||||||    
T  10911199 gagacgctcattcttgcctgagttgtgtacaatctcagcgagc-ttttcatattt----tttttttgtcccttatttttgcctggaccgccctttcgggt 10911293  T
Q  190 tttcga 195  Q
    ||||||    
T  10911294 tttcga 10911299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 1890265 - 1890341
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  1890265 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 1890341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 27971365 - 27971452
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  27971365 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcattttttgcttaagccgccctttcgggttttcgac 27971452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 16267904 - 16267990
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||||| |||||| |||| ||||| ||||    
T  16267904 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcctaagccgccttttcaggtttgcgac 16267990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 5204232 - 5204319
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  5204232 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 5204319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 13836786 - 13836699
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  13836786 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 13836699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 163 - 249
Target Start/End: Original strand, 16390806 - 16390893
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctacc 249  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||    
T  16390806 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttacc 16390893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 3451843 - 3451765
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||||||||||||||||||| || ||||| ||||  || |||||||||||| | ||||||| |||||||||    
T  3451843 atttttgcctggatcgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgcccttccgggttttc 3451765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 11418392 - 11418470
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||||  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11418392 atttttgcctggactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11418470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 291
Target Start/End: Original strand, 30367318 - 30367448
Alignment:
Q  163 atttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | ||||| ||||||||||||||| ||||  |||||||||    
T  30367318 atttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgcccttttcgggttttcgacttaccgagctgttctt 30367417  T
Q  261 ttcatatatctaggcgaagtatttcttgact 291  Q
    || | |  | ||| | |||||||||||||||    
T  30367418 ttaaaaattttagacaaagtatttcttgact 30367448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 39206753 - 39206831
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  39206753 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 39206831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 2161162 - 2161121
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2161162 atttttgcctggatcgccctttcgggttttcgatccaccggg 2161121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 2779836 - 2779795
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2779836 atttttgcctggatcgccctttcgggttttcgatccaccggg 2779795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5154673 - 5154632
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5154673 atttttgcctggatcgccctttcgggttttcgatccaccggg 5154632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5164975 - 5164934
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  5164975 atttttgcctggatcgccctttcgggttttcgatccaccggg 5164934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 10848175 - 10848134
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10848175 atttttgcctggatcgccctttcgggttttcgatccaccggg 10848134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 10910473 - 10910514
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  10910473 atttttgcctggatcgccctttcgggttttcgatccaccggg 10910514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 11418326 - 11418367
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  11418326 atttttgcctggatcgccctttcgggttttcgatccaccggg 11418367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 16511987 - 16512028
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16511987 atttttgcctggatcgccctttcgggttttcgatccaccggg 16512028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 24586082 - 24586123
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24586082 atttttgcctggatcgccctttcgggttttcgatccaccggg 24586123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 24586148 - 24586229
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  24586148 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 24586229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 26268632 - 26268673
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26268632 atttttgcctggatcgccctttcgggttttcgatccaccggg 26268673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 26441841 - 26441800
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26441841 atttttgcctggatcgccctttcgggttttcgatccaccggg 26441800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 26596260 - 26596219
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26596260 atttttgcctggatcgccctttcgggttttcgatccaccggg 26596219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 26663459 - 26663500
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26663459 atttttgcctggatcgccctttcgggttttcgatccaccggg 26663500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 26678651 - 26678692
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  26678651 atttttgcctggatcgccctttcgggttttcgatccaccggg 26678692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31557941 - 31557982
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31557941 atttttgcctggatcgccctttcgggttttcgatccaccggg 31557982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 39206687 - 39206728
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  39206687 atttttgcctggatcgccctttcgggttttcgatccaccggg 39206728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 164 - 204
Target Start/End: Original strand, 4138793 - 4138833
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  4138793 tttttgcctggatcgccctttcgggttttcgatccaccggg 4138833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 220 - 308
Target Start/End: Original strand, 13482633 - 13482724
Alignment:
Q  220 taggccgccctttcgggttttcgacctaccacgctgttctttt-ca--tatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    ||||||||||||||||||||||| ||||||  ||||||||||| ||  ||||||||| | |||||||||||||||  ||||| |||||||||    
T  13482633 taggccgccctttcgggttttcgccctaccgagctgttcttttacatgtatatctagacaaagtatttcttgactgcatcagaattcacagg 13482724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 564273 - 564360
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||||||| || ||||||| || ||  |||||||||||||||||||||    
T  564273 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaaaccgccctttcgggttttcgac 564360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 90 - 145
Target Start/End: Complemental strand, 3451176 - 3451122
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttg 145  Q
    ||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||    
T  3451176 gagacgctcattcttgcctgagttgtgtataatctcagcgagc-ttttcatatttg 3451122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 27439654 - 27439567
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||| ||||| || ||||||| || ||  |||||||||||||||||||||    
T  27439654 ccctaatttttgcctggaccgccctttcgggttttcagtccatcgggacgctcatttttggcttaaaccgccctttcgggttttcgac 27439567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 16745133 - 16745211
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| | |||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  16745133 atttttgcctgaaccgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 16745211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 22148479 - 22148441
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||||||||||||||||||||||||||||    
T  22148479 atttttgcctggatcgccctttcgggttttcgatccacc 22148441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 22152706 - 22152668
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||||||||||||||||||||||||||||    
T  22152706 atttttgcctggatcgccctttcgggttttcgatccacc 22152668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 22208621 - 22208583
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||||||||||||||||||||||||||||    
T  22208621 atttttgcctggatcgccctttcgggttttcgatccacc 22208583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 26519315 - 26519237
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  26519315 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 26519237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 31130423 - 31130345
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31130423 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31130345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 31558007 - 31558085
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31558007 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31558085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 45737827 - 45737749
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  45737827 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 45737749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 5140881 - 5140922
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||| |||||||||||||||||||||||||||||    
T  5140881 atttttgcctggctcgccctttcgggttttcgatccaccggg 5140922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 11447478 - 11447437
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||| |||||||||||||||||||||||||    
T  11447478 atttttgcctggatcgtcctttcgggttttcgatccaccggg 11447437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 12589388 - 12589347
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  12589388 ttttgcctggatcgccctttcgggttttcaatccaccgggaa 12589347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 200
Target Start/End: Complemental strand, 16047903 - 16047866
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccac 200  Q
    ||||||||||||||||||||||||||||||||||||||    
T  16047903 atttttgcctggatcgccctttcgggttttcgatccac 16047866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 16268608 - 16268689
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  16268608 atttctgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 16268689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 16443550 - 16443591
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||| ||||||||||||||||||||||||||||    
T  16443550 atttttgcctggaccgccctttcgggttttcgatccaccggg 16443591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 26313396 - 26313437
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||| |||||||||||||||||||||||||    
T  26313396 atttttgcctggatcgtcctttcgggttttcgatccaccggg 26313437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 26519381 - 26519340
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  26519381 atttttgcctggatcgccctttcgggttttcgatccatcggg 26519340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 31084235 - 31084316
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  31084235 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 31084316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 31130489 - 31130448
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  31130489 atttttgcctggatcgccttttcgggttttcgatccaccggg 31130448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 45393809 - 45393768
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  45393809 atttttgcctggatcgccctttcgggttttcgatccatcggg 45393768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 45737893 - 45737852
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  45737893 atttttgcctggatcgccctttcgggttttcgacccaccggg 45737852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 260
Target Start/End: Original strand, 795912 - 795996
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  795912 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 795996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 4205979 - 4205939
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgg 203  Q
    ||||||||||||||||||||||||||||||| |||||||||    
T  4205979 atttttgcctggatcgccctttcgggttttcaatccaccgg 4205939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 260
Target Start/End: Original strand, 16284768 - 16284852
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    |||||||||||||||||   |||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  16284768 cgccctttcgggttttcagcccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 16284852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 244
Target Start/End: Original strand, 1956304 - 1956371
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||| |||||||  |||||||||| || |||||||||||| |||||| |||| ||||||||||    
T  1956304 cgccctttcaggttttcagtccaccgggacgctcatttttgcctaagccgccttttcaggttttcgac 1956371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 9472732 - 9472649
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || | || ||||||| | |||| |||| |||||||    
T  9472732 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctctttgttgcctaagtcgccttttcaggttttc 9472649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 241
Target Start/End: Complemental strand, 11447397 - 11447334
Alignment:
Q  178 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11447397 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11447334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 201
Target Start/End: Original strand, 16124570 - 16124613
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  16124570 ccctaatttttacctggatcgccctttcgggttttcgatccacc 16124613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 26509242 - 26509285
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| | ||||||||||||||||||||||||||||||    
T  26509242 atttttgcctgaaccgccctttcgggttttcgatccaccgggaa 26509285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 201
Target Start/End: Complemental strand, 29092932 - 29092889
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  29092932 ccctaatttttacctggatcgccctttcgggttttcgatccacc 29092889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 34135471 - 34135550
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  34135471 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 34135550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 38409123 - 38409036
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| ||||||||| |||||||  |||| | ||| || ||||||| || || ||||||||||||||||||||||    
T  38409123 ccctaatttttgcctggaccgccctttcaggttttcactccatcaggacgctcatttttggcttaagccgccctttcgggttttcgac 38409036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 244
Target Start/End: Original strand, 3426982 - 3427064
Alignment:
Q  162 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||||||||| |||||||||||||||||   |||||  || || |||||||||||| |||||| |||| ||||| ||||    
T  3426982 tatttttgcctggaccgccctttcgggttttcagaccaccaagacgctcatttttgcctaagccgccttttcaggtttgcgac 3427064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 4205913 - 4205835
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||| | || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  4205913 atttttgcctgaactgccctttcggggtgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 4205835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 5140947 - 5141025
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| || |  || |||||||||||| |||||||||||||||||||    
T  5140947 atttttgcctgaactgccctttcgggttgtcaatccagcgaggtgctcatttttgcctaagccgccctttcgggttttc 5141025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5154607 - 5154529
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  5154607 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 5154529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 10848109 - 10848031
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||| || | |||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  10848109 atttttgcgtgaaccgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 10848031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 10910539 - 10910617
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  10910539 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 10910617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 13836861 - 13836811
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||| | ||||||||||| ||||||||||||||||| ||||||||||||    
T  13836861 gtccctaacttttgcctggaccgccctttcgggttttcaatccaccgggaa 13836811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 26268698 - 26268776
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  26268698 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 26268776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 26313462 - 26313540
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  26313462 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 26313540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 26663525 - 26663603
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  26663525 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 26663603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 26678717 - 26678795
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  26678717 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 26678795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 45393743 - 45393665
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  45393743 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 45393665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 564209 - 564250
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  564209 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 564250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 4942935 - 4942976
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||||||||||| ||||    
T  4942935 ttttgcctggaccgccctttcgggttttcgatccaccaggaa 4942976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 5204168 - 5204209
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  5204168 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 5204209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 8816139 - 8816090
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  8816139 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 8816090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 9472796 - 9472747
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  9472796 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 9472747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 16390073 - 16390122
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  16390073 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 16390122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 16482197 - 16482238
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||||| ||||||||||||||| ||||||||||||    
T  16482197 ttttgcctggatctccctttcgggttttcaatccaccgggaa 16482238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 23881145 - 23881194
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  23881145 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 23881194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 27971301 - 27971342
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  27971301 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 27971342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 29027802 - 29027761
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||||||||||||| ||||||||||||    
T  29027802 ttttgtctggatcgccctttcgggttttcaatccaccgggaa 29027761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31084169 - 31084210
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||||||||||||| ||||||||    
T  31084169 atttttgcttggatcgccctttcgggttttcgacccaccggg 31084210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 38409187 - 38409146
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  38409187 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 38409146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 42632819 - 42632868
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  42632819 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 42632868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 30366618 - 30366666
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  30366618 tccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 30366666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 563195 - 563234
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||| |||| |||||||||||    
T  563195 ttttgcctggatcgccctttcggattttggatccaccggg 563234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 844228 - 844181
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  844228 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 844181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 851404 - 851357
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  851404 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 851357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 1209408 - 1209361
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  1209408 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 1209361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 3426271 - 3426318
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  3426271 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 3426318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 4942998 - 4943085
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||||||||  ||| ||||||||| || ||||||||||| || | ||||| || || |||||||||| |||||||||||    
T  4942998 ccctaatttttgcctggactgccttttcgggttctcaatccaccgggacgctcgtttttggcttaagccgccctttagggttttcgac 4943085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 8816075 - 8816028
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  8816075 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 8816028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 16240885 - 16240846
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  16240885 ttttgcctggatcgtcctttcggattttcgatccaccggg 16240846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 16390140 - 16390187
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  16390140 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 16390187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 241
Target Start/End: Original strand, 16443631 - 16443694
Alignment:
Q  178 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  16443631 gccctttcgggttatcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 16443694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 22152620 - 22152561
Alignment:
Q  182 tttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22152620 tttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22152561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 22208535 - 22208476
Alignment:
Q  182 tttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22208535 tttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22208476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 42632885 - 42632932
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  42632885 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 42632932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 2161096 - 2161018
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||  ||||||||    
T  2161096 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttctgggttttc 2161018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 2559949 - 2559903
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||| |||||| |||||||||| ||||||||||||| ||||||||||    
T  2559949 ccctaatttttacctggatcgcactttcgggttttcaatccaccggg 2559903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 2779770 - 2779692
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |   ||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  2779770 atttttgcctgaacttccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 2779692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 4138858 - 4138936
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||| | | |||||||||||||||||    
T  4138858 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcccaagtcgccctttcgggttttc 4138936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5164908 - 5164830
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||| ||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  5164908 atttttgcctgaactgccttttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 5164830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 12588611 - 12588557
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttg 217  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||    
T  12588611 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttg 12588557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 16047837 - 16047759
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |  ||||||||||||||||    
T  16047837 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagttgccctttcgggttttc 16047759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Complemental strand, 16240814 - 16240772
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||||| ||||||||||||||||||||||    
T  16240814 ccctaatttttacctggatcaccctttcgggttttcgatccac 16240772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 203
Target Start/End: Original strand, 16267844 - 16267882
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgg 203  Q
    |||||||| |||||||||||||||||||| |||||||||    
T  16267844 ttttgcctagatcgccctttcgggttttcaatccaccgg 16267882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 16512053 - 16512131
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||| |||| ||||||||| |||||||||    
T  16512053 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcattttttcctaagccgcccttccgggttttc 16512131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 16745070 - 16745108
Alignment:
Q  167 ttgcctggatcgcccttt-cgggttttcgatccaccggg 204  Q
    |||||||||||||||||| ||||||||||||||||||||    
T  16745070 ttgcctggatcgcccttttcgggttttcgatccaccggg 16745108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 26596194 - 26596116
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||| ||| ||||||||| |||||||||    
T  26596194 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgtctaagccgcccttccgggttttc 26596116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 563260 - 563297
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||| |||||||||||||||| ||||||||    
T  563260 tttttgcctggaccgccctttcgggtttttgatccacc 563297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 27970372 - 27970413
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||| |||||||| |||| |||||||||||    
T  27970372 atttttgcctggatcgtcctttcggattttggatccaccggg 27970413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 29027738 - 29027650
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct--aggccgccctttcgggttttcgac 244  Q
    |||| |||||||| |||| || ||||||||||||||  |||| ||||| || |||||||| ||  |  |||||||||||||||||||||    
T  29027738 ccctaatttttgcttggaccgtcctttcgggttttcagtccatcgggacgctcatttttggcttaaaaccgccctttcgggttttcgac 29027650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 23881217 - 23881257
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  23881217 ttttgcctggaccgccctttcgggttttcagtccaccggga 23881257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 161; Significance: 7e-86; HSPs: 89)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 19202719 - 19202930
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||| |||||||||||||    
T  19202719 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 19202814  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  19202815 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 19202914  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  19202915 ctatatcggcattcac 19202930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 15773435 - 15773220
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  15773435 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 15773339  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15773338 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 15773239  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  15773238 ctatatcagcattcacagg 15773220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 19680309 - 19680095
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  19680309 gagacgctcattcttgcctgagttgtgtataatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 19680211  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  19680210 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 19680111  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  19680110 ctatatcagcattcac 19680095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 19693956 - 19693747
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  19693956 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcgggt 19693863  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  19693862 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 19693763  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  19693762 ctatatcggcattcac 19693747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 27603261 - 27603473
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  27603261 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 27603357  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||    
T  27603358 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaaatatttcttga 27603457  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  27603458 ctatatcagcattcac 27603473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 28356308 - 28356520
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  28356308 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttctttt--gtcccttatttttgcctggaccgccctttcgggt 28356404  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||    
T  28356405 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcgaagtatttcttga 28356504  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  28356505 ctatatcggcattcac 28356520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 33248227 - 33248018
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  33248227 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatatttttt------gtcccttatttttgcctggaccgccctttcgggt 33248134  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  33248133 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 33248034  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  33248033 ctatatcggcattcac 33248018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 19655699 - 19655911
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           ||||||||||||| |||||| |||||||||||||    
T  19655699 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatatttttt------gtcccttattttttcctggaccgccctttcgggt 19655792  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  19655793 tttcgatccaccaggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 19655892  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  19655893 ctatatcagcattcacagg 19655911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 9360483 - 9360273
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  9360483 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 9360389  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  9360388 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 9360289  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  9360288 ctatatcggcattcac 9360273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 12087079 - 12087291
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  12087079 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 12087175  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  12087176 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 12087275  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  12087276 ctatatcggcattcac 12087291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 16260084 - 16259866
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  16260084 gagatgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatattatttttttttgtcccttatttttgcctggaccgccctttcgggt 16259985  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| || |||||||||||||    
T  16259984 tttcgatccaccgggaagcgcatttttgcctaggccgccccttcgggttttcgacataccacgctgttcttttcatatttctaagcaaagtatttcttga 16259885  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  16259884 ctatatcagcattcacagg 16259866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 22138768 - 22138553
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||| |           |||||||||||||||||||| |||||||||||||    
T  22138768 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctctttcatatatatattttt---gtcccttatttttgcctggaccgccctttcgggt 22138672  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  22138671 tttcaatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 22138572  T
Q  290 ctatatcagcattcacagg 308  Q
     ||||||||||||||||||    
T  22138571 atatatcagcattcacagg 22138553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 18715343 - 18715132
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  18715343 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 18715248  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  18715247 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 18715148  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18715147 ctatatcggcattcac 18715132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 21342526 - 21342739
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  21342526 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 21342623  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  21342624 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 21342723  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  21342724 ctatatcggcattcac 21342739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 29835184 - 29834973
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  29835184 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 29835089  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  29835088 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 29834989  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  29834988 ctatatcggcattcac 29834973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 31484227 - 31484439
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  31484227 gagacgctcattcttgcctgagttgtgtacaatctcagcgaactttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 31484323  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  31484324 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 31484423  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31484424 ctatatcggcattcac 31484439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 18796567 - 18796352
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||||| |          | |||||||||||||||||||| ||||||||||||    
T  18796567 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttt-catatatatttttttttgtgtcccttatttttgcctggaccgccctttcggg 18796469  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  18796468 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 18796369  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  18796368 actatatcggcattcac 18796352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 2131617 - 2131828
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  2131617 gagacgctcattcttgcctgagttgtatacaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggt 2131712  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  2131713 tttcgatccaccgggaagcccatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 2131812  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  2131813 ctatatcggcattcac 2131828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 14569018 - 14568807
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||| ||||||| |||||||||||||    
T  14569018 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatctttttgt---gtcccttatttt-gcctggaccgccctttcgggt 14568923  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  14568922 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 14568823  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  14568822 ctatatcggcattcac 14568807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 33264592 - 33264382
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  33264592 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttt-catatatttttttt----gtcccttatttttgcctggaccgccctttcgggt 33264498  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  33264497 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 33264398  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  33264397 ctatatcggcattcac 33264382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 44566842 - 44566632
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  44566842 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggt 44566748  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  44566747 tttcgatccaccgggaagcgcatttttgcataggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 44566648  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  44566647 ctatatcggcattcac 44566632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 19911519 - 19911730
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||| ||| |           |||||||||||| ||||||| |||||||||||||    
T  19911519 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcgtatatattttttt---gtcccttatttt-gcctggaccgccctttcgggt 19911614  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||| |||||||||||||    
T  19911615 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgaccaaccacgttgttcttttcatatttctaggcaaagtatttcttga 19911714  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  19911715 ctatatcggcattcac 19911730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 31360389 - 31360177
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  31360389 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 31360293  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| || ||||||||||    
T  31360292 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaaatatttcttga 31360193  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31360192 ctatatcggcattcac 31360177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 22075284 - 22075496
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||           |||||||||||| ||||||||||||  ||||||    
T  22075284 gagacgctcattcttgcctaagttgcgtacaatctcagcgagcttttttcatttttttttt------gtcccttatttt-gcctggatcgccagttcggg 22075376  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||  | ||  ||||||||    
T  22075377 ttttcgacccaccgggaagcgcgtttttgccaaggccgccctttcgggttttcgaccttccacgctgttcttttcatacatctaaacaaacaatttcttg 22075476  T
Q  289 actatatcagcattcacagg 308  Q
    |||||||| |||||||||||    
T  22075477 actatatcggcattcacagg 22075496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 14214805 - 14214660
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  14214805 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 14214706  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  14214705 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 14214660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 22414704 - 22414559
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  22414704 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 22414605  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  22414604 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 22414559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 185 - 305
Target Start/End: Complemental strand, 16288721 - 16288601
Alignment:
Q  185 cgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtattt 284  Q
    |||||||||||||| || ||||| | | ||||||||||||| ||| ||||||||||| |||| ||||||||||||||| |||| | ||||| ||||||||    
T  16288721 cgggttttcgatccccccggaaggggaattttgcctaggcccccccttcgggttttccacctcccacgctgttctttttatatttttaggcaaagtattt 16288622  T
Q  285 cttgactatatcagcattcac 305  Q
     ||||||| ||| ||||||||    
T  16288621 tttgactaaatcggcattcac 16288601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 158 - 249
Target Start/End: Complemental strand, 19847615 - 19847523
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctacc 249  Q
    |||| ||||||||||||| ||||||||||||||||||||||||||||  || | ||||| |  ||||||||||||||||||||||||||||||    
T  19847615 ccctaatttttgcctggaccgccctttcgggttttcgatccaccggggcgctcctttttggtttaggccgccctttcgggttttcgacctacc 19847523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 16771091 - 16770944
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | ||||||||||||||||||||| |||||||  ||||||||||    
T  16771091 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 16770992  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  16770991 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 16770944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 19846933 - 19846784
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||   |||||| || || ||||||||  | |||||||||||||||||||||||||||||  | ||||||||    
T  19846933 atttttgcctggaccgccctttcgggttttcagcccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagttgttcttt 19846834  T
Q  262 t---catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |    |||||||||| | |||||||||||||||  ||| | |||||||||    
T  19846833 tatatatatatctagacaaagtatttcttgactgcatctgaattcacagg 19846784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 16771762 - 16771686
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  16771762 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 16771686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 28355639 - 28355720
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  28355639 atttttgcctgaattgccctttcgggttatcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 28355720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 25794130 - 25794054
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |||||||| |||||||| ||||||||||| || | |||||||||| |||||||||| ||||||||    
T  25794130 ttttgcctggaccgcccttttgggttttcaatccaccgggatgctcttttttgcctaagccgcccttttgggttttc 25794054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 31483493 - 31483536
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  31483493 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 31483536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 31483559 - 31483637
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  31483559 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 31483637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 33265250 - 33265172
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  33265250 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 33265172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 9361200 - 9361159
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9361200 atttttgcctggatcgccctttcgggttttcgatccaccggg 9361159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 12086346 - 12086387
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12086346 atttttgcctggatcgccctttcgggttttcgatccaccggg 12086387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 19654968 - 19655009
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  19654968 atttttgcctggatcgccctttcgggttttcgatccaccggg 19655009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 19694684 - 19694643
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  19694684 atttttgcctggatcgccctttcgggttttcgatccaccggg 19694643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22074552 - 22074593
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22074552 atttttgcctggatcgccctttcgggttttcgatccaccggg 22074593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 22139480 - 22139439
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22139480 atttttgcctggatcgccctttcgggttttcgatccaccggg 22139439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 27602537 - 27602578
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27602537 atttttgcctggatcgccctttcgggttttcgatccaccggg 27602578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 28355573 - 28355614
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  28355573 atttttgcctggatcgccctttcgggttttcgatccaccggg 28355614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 33248958 - 33248917
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33248958 atttttgcctggatcgccctttcgggttttcgatccaccggg 33248917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 33265316 - 33265275
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33265316 atttttgcctggatcgccctttcgggttttcgatccaccggg 33265275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 17677678 - 17677765
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || || |||| || || ||||||||||||||||||||||    
T  17677678 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcacttttggcttaagccgccctttcgggttttcgac 17677765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 22158751 - 22158834
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| || ||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  22158751 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccttttcaggttttc 22158834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 241
Target Start/End: Complemental strand, 29835850 - 29835771
Alignment:
Q  162 tatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  29835850 tatttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 29835771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 39840292 - 39840379
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| |  ||||||| || || ||||||||||||||||||||||    
T  39840292 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgttcatttttggcttaagccgccctttcgggttttcgac 39840379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 18716009 - 18715931
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  18716009 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 18715931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 18797300 - 18797262
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||||||||||||||||||||||||||||    
T  18797300 atttttgcctggatcgccctttcgggttttcgatccacc 18797262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 21341859 - 21341937
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  21341859 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 21341937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 31361055 - 31360977
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  31361055 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 31360977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 2130894 - 2130931
Alignment:
Q  167 ttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||    
T  2130894 ttgcctggatcgccctttcgggttttcgatccaccggg 2130931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 14569748 - 14569707
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
T  14569748 atttttgcctgaatcgccctttcgggttttcgatccaccggg 14569707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 15774167 - 15774126
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
T  15774167 atttttgcctggatcaccctttcgggttttcgatccaccggg 15774126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 18716075 - 18716034
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  18716075 atttttgcatggatcgccctttcgggttttcgatccaccggg 18716034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 19681040 - 19680999
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  19681040 atttttgcctggatcgccctttcgggttttcgatccatcggg 19680999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 19910785 - 19910826
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||| ||||||||||||||||||||||    
T  19910785 atttttgcctggatcgccccttcgggttttcgatccaccggg 19910826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 21341793 - 21341834
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  21341793 atttttgcctggatcgccctttcgggttttcgatccatcggg 21341834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 22090985 - 22091026
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  22090985 ttttgcctggatcgccctttcgggttttcaatccaccgggaa 22091026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 29835915 - 29835874
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  29835915 atttttgcctggatcgccctttcgggttttcaatccaccggg 29835874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 31361121 - 31361080
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
T  31361121 atttttgcctggatcaccctttcgggttttcgatccaccggg 31361080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 44567576 - 44567535
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  44567576 atttttgcctggatcgccctttcgggttttcaatccaccggg 44567535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 12086412 - 12086490
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  12086412 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 12086490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 15774101 - 15774023
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  15774101 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 15774023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 19202064 - 19202142
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  19202064 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 19202142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 19655034 - 19655112
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  19655034 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 19655112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 19680974 - 19680896
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || ||||||||| || |||||||||||||||||||    
T  19680974 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcttaagccgccctttcgggttttc 19680896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 22139414 - 22139336
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  22139414 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 22139336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 27602603 - 27602681
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  27602603 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 27602681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 156 - 206
Target Start/End: Original strand, 39840219 - 39840269
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||| | ||||||||||| ||||||||||||||||| ||||||||||||    
T  39840219 gtccctaacttttgcctggaccgccctttcgggttttcaatccaccgggaa 39840269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 44567510 - 44567432
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  44567510 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 44567432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 196
Target Start/End: Complemental strand, 16260505 - 16260472
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgat 196  Q
    ||||||||||||||||||||||||||||||||||    
T  16260505 atttttgcctggatcgccctttcgggttttcgat 16260472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 17677613 - 17677654
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  17677613 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 17677654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 19202000 - 19202037
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccg 202  Q
    |||||||||||||| |||||||||||||||||||||||    
T  19202000 ttttgcctggatcgtcctttcgggttttcgatccaccg 19202037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 32003969 - 32003888
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || ||||||| |||| |||||| |||| ||||| ||||    
T  32003969 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcattttttcctaagccgccttttcaggtttgcgac 32003888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 33248892 - 33248811
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| ||||||||||||    
T  33248892 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcctttttgcctaagccgcccttccgggttttcgac 33248811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 21477810 - 21477894
Alignment:
Q  158 cccttatttttgcctggatcgcccttt-cgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||| |||||||||  ||||||| || || |||||||||||| | |||| |||| |||||||    
T  21477810 ccctaatttttgcctggaccgcccttttcgggttttcagtccaccgagacgctcatttttgcctaagtcgccatttcaggttttc 21477894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 19847676 - 19847637
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||| |||||||| ||||||||||||||||    
T  19847676 ttttgcctggatcgtcctttcggattttcgatccaccggg 19847637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 241
Target Start/End: Original strand, 22074633 - 22074696
Alignment:
Q  178 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  22074633 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 22074696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 22159456 - 22159535
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||| |||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  22159456 ttttgcttggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 22159535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Complemental strand, 14215449 - 14215407
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  14215449 ccctaatttttacctggaccgccctttcgggttttcgatccac 14215407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 18797234 - 18797156
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| | |||||||    
T  18797234 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccaggttttc 18797156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 19694618 - 19694540
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || |||||  |||  || |||||||||||| ||||||||| |||||||||    
T  19694618 atttttgcctgaactgccctttcgggttgtcaatccagaggggtgctcatttttgcctaagccgcccttccgggttttc 19694540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 19910851 - 19910929
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || || ||||||||| ||||||||| |||||||||    
T  19910851 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcaattttgcctaagccgcccttccgggttttc 19910929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 205
Target Start/End: Complemental strand, 20731866 - 20731824
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||||| |||||||||||||||||  ||||||||||    
T  20731866 atttttgcctggaccgccctttcgggttttcagtccaccggga 20731824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 22415447 - 22415411
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||||||||||||| |||||||| |||||||||||||    
T  22415447 ttttgcctggatcgtcctttcggattttcgatccacc 22415411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 161; Significance: 7e-86; HSPs: 143)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 13930929 - 13931143
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||         | ||||||||||||||||||| |||||||||||||    
T  13930929 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 13931027  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  13931028 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 13931127  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  13931128 ctatatcggcattcac 13931143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 3788353 - 3788141
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  3788353 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 3788257  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  3788256 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 3788157  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  3788156 ctatatcggcattcac 3788141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 12661398 - 12661185
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  12661398 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatttttttttt--gtcccttatttttgcctggaccgccctttcgggt 12661301  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  12661300 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 12661201  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  12661200 ctatatcagcattcac 12661185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 20843772 - 20843561
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  20843772 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggt 20843677  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  20843676 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 20843577  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  20843576 ctatatcagcattcac 20843561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 34269303 - 34269516
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  34269303 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatatttttttttt--gtcccttatttttgcctggaccgccctttcgggt 34269400  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  34269401 tttcgatccaccgggaagcgtatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 34269500  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  34269501 ctatatcagcattcac 34269516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 34297016 - 34296802
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||         | |||||||||||||||||||||||||||||||||    
T  34297016 gagacgctcattcttgcctgagttgcgtgcaatctcaacgagctttttcatatttgtttttttttg-tcccttatttttgcctggatcgccctttcgggt 34296918  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||    
T  34296917 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatgtttctaggcaaagtatttcttga 34296818  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  34296817 ctatatcggcattcac 34296802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 39895927 - 39895717
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  39895927 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 39895833  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  39895832 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 39895733  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  39895732 ctatatcggcattcac 39895717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 21697557 - 21697769
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||           ||||||||||||||||| || |||||||||||||    
T  21697557 gagacgctcattcttgcctgagttgcgtacaatctcaacgagctttt-catattttttttt-----gtcccttatttttgcctagaccgccctttcgggt 21697650  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  21697651 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttga 21697750  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  21697751 ctatatcagcattcacagg 21697769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 255035 - 255249
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  255035 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 255133  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||    
T  255134 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttttatatttctaggcaaagtatttcttga 255233  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  255234 ctatatcggcattcac 255249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 9344370 - 9344582
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  9344370 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 9344466  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  9344467 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 9344566  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  9344567 ctatatcggcattcac 9344582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 27428829 - 27429037
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  27428829 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatattttt-------gtcccttatttttgcctggaccgccctttcgggt 27428921  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27428922 tttcgatccaccgggaagcgcatttctgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27429021  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  27429022 ctatatcagcattcac 27429037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 32055662 - 32055451
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  32055662 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 32055567  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  32055566 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 32055467  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  32055466 ctatatcggcattcac 32055451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 37383536 - 37383325
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  37383536 gagacgctcattcttgcctgagttgcgttcaatctcagcgagctttt-catatttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 37383441  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  37383440 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 37383341  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  37383340 ctatatcggcattcac 37383325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 37931231 - 37931017
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  37931231 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggt 37931133  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  37931132 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 37931033  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  37931032 ctatatcggcattcac 37931017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 19450810 - 19451022
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||          |||||||||||| |||||||||||||||||||||    
T  19450810 gagacgctcattcttgcctgagttgcgtacaacctcagcgagctttttcatatttgttttt-----gtcccttatttt-gcctggatcgccctttcgggt 19450903  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||    
T  19450904 ttttgatccaccgggaagcgcatttttgccaaggcggccctttcgggttttcgaccttccacgctgttcttttcatatatctaggcaaagtatttcttga 19451003  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  19451004 ctatatcagcattcacagg 19451022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 34160703 - 34160492
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  34160703 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 34160608  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  34160607 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 34160508  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  34160507 ctatatcagcattcac 34160492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 22922528 - 22922744
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng--gtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||            |||||||||||||||||||| |||||||||||    
T  22922528 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttttttttgtcccttatttttgcctggaccgccctttcgg 22922626  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  22922627 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttctt 22922726  T
Q  288 gactatatcagcattcac 305  Q
    ||||||||| ||||||||    
T  22922727 gactatatcggcattcac 22922744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 37680276 - 37680491
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||    
T  37680276 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcggg 37680374  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  37680375 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 37680474  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  37680475 actatatcggcattcac 37680491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 37695541 - 37695756
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||    
T  37695541 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcggg 37695639  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  37695640 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 37695739  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  37695740 actatatcggcattcac 37695756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 11629567 - 11629780
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| | |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  11629567 gagacgctcattcttgcctgagttgcatgcaatctcagcgagctttttcatatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 11629664  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  11629665 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 11629764  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  11629765 ctatatcggcattcac 11629780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 12592669 - 12592456
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||         | |||||||||||||| |||| |||||||||||||    
T  12592669 gagacgctcattcttgcctgatttgcgtacaatctcagcgagctttt-catatgtgtttttttttg-tcccttatttttgcttggaccgccctttcgggt 12592572  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  12592571 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 12592472  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  12592471 ctatatcggcattcac 12592456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 16167337 - 16167128
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  16167337 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 16167244  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  16167243 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 16167144  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  16167143 ctatatcggcattcac 16167128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27122384 - 27122172
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||||| |           |||||||| ||||||||||| |||||||||||||    
T  27122384 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagcttttccatatatattttttt---gtcccttagttttgcctggaccgccctttcgggt 27122288  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27122287 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27122188  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27122187 ctatatcggcattcac 27122172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27782091 - 27781882
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  27782091 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 27781998  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27781997 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27781898  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27781897 ctatatcggcattcac 27781882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27821848 - 27821639
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  27821848 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 27821755  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27821754 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27821655  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27821654 ctatatcggcattcac 27821639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 31887876 - 31888087
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  31887876 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 31887971  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  31887972 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 31888071  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31888072 ctatatcggcattcac 31888087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 34867542 - 34867332
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  34867542 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatttttt----gtcccttatttttgcctggaccgccctttcgggt 34867448  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||    
T  34867447 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtacttcttga 34867348  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  34867347 ctatatcggcattcac 34867332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 39046205 - 39046415
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||          |||||||||||||||||||| |||||||||||||    
T  39046205 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttt-catttttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 39046299  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  39046300 tttcgatccaccaggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 39046399  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  39046400 ctatatcggcattcac 39046415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 21671556 - 21671771
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng-gtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| || |||||||||||||||||| ||||||||           |||||||||||||||||||| ||||||||||||    
T  21671556 gagacgctcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttttttttttgtcccttatttttgcctggaccgccctttcggg 21671654  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  21671655 ttttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 21671754  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  21671755 actatatcggcattcac 21671771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 12710984 - 12711197
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  12710984 gagacgctcattcttgcctgagttgtatacaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 12711081  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||    
T  12711082 tttcgatccatcgggaagcgcatttttgcctaggccgccctttcgggttttcgacctatcacgctgttcttttcatatttctaggcaaagtatttcttga 12711181  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  12711182 ctatatcggcattcac 12711197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 27809560 - 27809351
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||| ||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  27809560 gagacgcacattcttgcctgagttgtgtacaatctcagcgagctttt-catatattttttt-----gtcccttatttttgcctggaccgccctttcgggt 27809467  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  27809466 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 27809367  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  27809366 ctatatcggcattcac 27809351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 28888138 - 28887927
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  28888138 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 28888043  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  28888042 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 28887943  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  28887942 ctatatcggcattcac 28887927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 31882146 - 31881934
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  31882146 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 31882050  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  31882049 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 31881950  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  31881949 ctatatcggcattcac 31881934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 90 - 302
Target Start/End: Original strand, 16823723 - 16823931
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  16823723 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 16823818  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  16823819 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 16823918  T
Q  290 ctatatcagcatt 302  Q
    ||||||| |||||    
T  16823919 ctatatcggcatt 16823931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 90 - 302
Target Start/End: Complemental strand, 16897757 - 16897549
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  16897757 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatatattttttt---gtcccttatttttgcctggaccgccctttcgggt 16897662  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  16897661 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 16897562  T
Q  290 ctatatcagcatt 302  Q
    ||||||| |||||    
T  16897561 ctatatcggcatt 16897549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 23122956 - 23123165
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| | |||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  23122956 gagacgctcattcttgcctgagttgcatgcaatctcagcgagctttt-catatatattttt-----gtcccttatttttgcctggaccgccctttcgggt 23123049  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  23123050 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatgtctaggcaaagtatttcttga 23123149  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  23123150 ctatatcggcattcac 23123165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 37946249 - 37946458
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||           |||||||||||||||||||| |||||||||||||    
T  37946249 gagacgctcgttcttgcctgatttgcgtacaatctcagcgagctttt-catattttttttt-----gtcccttatttttgcctggaccgccctttcgggt 37946342  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||| |||||||||||||    
T  37946343 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctattcttttcatgtttctaggcaaagtatttcttga 37946442  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  37946443 ctatatcggcattcac 37946458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 40239368 - 40239156
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||| ||||||||  |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  40239368 gagacgctcattcttgtctgagttgtttacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 40239272  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||||    
T  40239271 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccgcgctgttcttttcatatttttaggcaaagtatttcttga 40239172  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  40239171 ctatatcggcattcac 40239156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 156 - 305
Target Start/End: Original strand, 19410948 - 19411097
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19410948 gtcccttatttttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctg 19411047  T
Q  256 ttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    ||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  19411048 ttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 19411097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 90 - 272
Target Start/End: Complemental strand, 27396182 - 27396001
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt--catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||          |||||||||||| |||||||||||||||| ||    
T  27396182 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttttcatatttgtttttttt--gtcccttatttt-gcctggatcgcccttttgg 27396086  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatcta 272  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  27396085 gttttcgatccaccaggaagcgcatttttgcctaggccgccctttcgggttttcgaccttccacgctgttcttttcatatatcta 27396001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 42396301 - 42396156
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  42396301 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 42396202  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  42396201 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 42396156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 34703842 - 34703697
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  34703842 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 34703743  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||  |||||||||    
T  34703742 t-atatatttagacaaagtatttcttgactgcatcaaaattcacagg 34703697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 163 - 262
Target Start/End: Original strand, 34531927 - 34532027
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  34531927 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 34532026  T
Q  262 t 262  Q
    |    
T  34532027 t 34532027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 261
Target Start/End: Complemental strand, 22952159 - 22952060
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  22952159 atttttgcctggaccgccctttcgggttttcagtccaccgagatgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 22952060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 26721752 - 26721899
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |  |||||||||||||||||||||| |||||||  ||||||||||    
T  26721752 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcaacctaccgagctgttcttt 26721851  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  | | || ||| | |||||||||||||||  ||||| |||||||||    
T  26721852 tataaacatttagacaaagtatttcttgactgcatcagaattcacagg 26721899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 13930261 - 13930342
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||||||||||||||||||||||||||| |||   || |||| ||||||| ||||||||| ||||||||||||    
T  13930261 atttttgcctggatcgccctttcgggttttcgatccagcggagtgctcattcttgcctaagccgcccttccgggttttcgac 13930342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 39045537 - 39045618
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||||||||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  39045537 atttttgcctggatcgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttcgac 39045618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 26721081 - 26721157
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||  |||||||||||||||| ||||||||||| || | |||||||||| |||||||||||||||||||    
T  26721081 ttttgcctggactgccctttcgggttttcaatccaccgggatgctcttttttgcctaagccgccctttcgggttttc 26721157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 3761100 - 3761187
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  3761100 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 3761187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 34531245 - 34531321
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||||||||||||||||||||| ||||||||||| || |  |||| |||| || ||||||||||||||||    
T  34531245 ttttgcctggatcgccctttcgggttttcaatccaccgggacgctctcttttacctaagctgccctttcgggttttc 34531321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 42569227 - 42569314
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| |||||||||||||  |||||||||||||||| ||||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  42569227 ccctaatttttgcctggactgccctttcgggttttcaatccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 42569314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 22921860 - 22921938
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  22921860 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 22921938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 254303 - 254344
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  254303 atttttgcctggatcgccctttcgggttttcgatccaccggg 254344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 9343638 - 9343679
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9343638 atttttgcctggatcgccctttcgggttttcgatccaccggg 9343679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 12593405 - 12593364
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12593405 atttttgcctggatcgccctttcgggttttcgatccaccggg 12593364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 12662082 - 12662041
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12662082 atttttgcctggatcgccctttcgggttttcgatccaccggg 12662041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 12710252 - 12710293
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12710252 atttttgcctggatcgccctttcgggttttcgatccaccggg 12710293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 16168069 - 16168028
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16168069 atttttgcctggatcgccctttcgggttttcgatccaccggg 16168028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 16822988 - 16823029
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16822988 atttttgcctggatcgccctttcgggttttcgatccaccggg 16823029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 16823054 - 16823135
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  16823054 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 16823135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 16898426 - 16898345
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  16898426 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 16898345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 16898492 - 16898451
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  16898492 atttttgcctggatcgccctttcgggttttcgatccaccggg 16898451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 19450069 - 19450110
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  19450069 atttttgcctggatcgccctttcgggttttcgatccaccggg 19450110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 20844505 - 20844464
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  20844505 atttttgcctggatcgccctttcgggttttcgatccaccggg 20844464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 22921794 - 22921835
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  22921794 atttttgcctggatcgccctttcgggttttcgatccaccggg 22921835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 23122227 - 23122268
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  23122227 atttttgcctggatcgccctttcgggttttcgatccaccggg 23122268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27396927 - 27396886
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27396927 atttttgcctggatcgccctttcgggttttcgatccaccggg 27396886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27782821 - 27782780
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27782821 atttttgcctggatcgccctttcgggttttcgatccaccggg 27782780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27810294 - 27810253
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  27810294 atttttgcctggatcgccctttcgggttttcgatccaccggg 27810253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31868437 - 31868478
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31868437 atttttgcctggatcgccctttcgggttttcgatccaccggg 31868478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 32056344 - 32056303
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  32056344 atttttgcctggatcgccctttcgggttttcgatccaccggg 32056303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 34161437 - 34161396
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  34161437 atttttgcctggatcgccctttcgggttttcgatccaccggg 34161396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 34868225 - 34868184
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  34868225 atttttgcctggatcgccctttcgggttttcgatccaccggg 34868184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 37945516 - 37945557
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  37945516 atttttgcctggatcgccctttcgggttttcgatccaccggg 37945557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 40240099 - 40240058
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40240099 atttttgcctggatcgccctttcgggttttcgatccaccggg 40240058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 21854655 - 21854742
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||| ||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  21854655 ccctaatttttgtctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 21854742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 28888843 - 28888804
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  28888843 ttttgcctggatcgccctttcgggttttcgatccaccggg 28888804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 35144103 - 35144016
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||| ||||||||||    
T  35144103 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcaggttttcgac 35144016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 11628902 - 11628980
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  11628902 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 11628980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 12593339 - 12593261
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||||  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  12593339 atttttgcctggactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 12593261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 16168003 - 16167925
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| |||||||||||||||||||    
T  16168003 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgccctttcgggttttc 16167925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 19410201 - 19410279
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  19410201 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 19410279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 90 - 136
Target Start/End: Original strand, 19410870 - 19410916
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt 136  Q
    |||||||||||||||||||||||||  ||||||||||||||||||||    
T  19410870 gagacgctcattcttgcctgagttgtatacaatctcagcgagctttt 19410916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 23122293 - 23122371
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  23122293 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 23122371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 24290582 - 24290500
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcga-tccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| ||||||||| | ||||  | |||||| ||| || |||||||||||| ||||||||||||||||||||||    
T  24290582 atttttgcctggaccgccctttcagttttttcagtccaccaggacgctcatttttgcctaagccgccctttcgggttttcgac 24290500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27123048 - 27122970
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  27123048 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 27122970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 37384202 - 37384124
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  37384202 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 37384124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 37931904 - 37931826
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  37931904 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 37931826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 40240033 - 40239955
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  40240033 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 40239955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 12387082 - 12387033
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||| |||||||||||    
T  12387082 tccctaatttttgcctggaccgccctttcgggttttcggtccaccgggaa 12387033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 19410135 - 19410176
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  19410135 atttttgcctggatcgccctttcgggttttcggtccaccggg 19410176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 23117388 - 23117347
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||| ||||||||||||||||||||||||||||||||||||    
T  23117388 attttcgcctggatcgccctttcgggttttcgatccaccggg 23117347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 27123114 - 27123073
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  27123114 atttttgcctggatcgccctttcgggttttcgacccaccggg 27123073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 27428104 - 27428145
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  27428104 atttttgcttggatcgccctttcgggttttcgatccaccggg 27428145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 31882877 - 31882836
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  31882877 atttttgcctggatcgccctttcgggttttcggtccaccggg 31882836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 34268581 - 34268618
Alignment:
Q  167 ttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||    
T  34268581 ttgcctggatcgccctttcgggttttcgatccaccggg 34268618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 34297740 - 34297699
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  34297740 atttttgcctagatcgccctttcgggttttcgatccaccggg 34297699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 37384268 - 37384227
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  37384268 atttttgcctggatcgccctttcgggttttcgacccaccggg 37384227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 37679542 - 37679583
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  37679542 atttttgcctggatcgccctctcgggttttcgatccaccggg 37679583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 37694807 - 37694848
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||| |||||||||||||||||||||    
T  37694807 atttttgcctggatcgccctctcgggttttcgatccaccggg 37694848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 37931970 - 37931929
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  37931970 atttttgcctggatcgccctttcgggttttcggtccaccggg 37931929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 39896659 - 39896618
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
T  39896659 atttttgcctggatcgccctttcgggttttcgatccatcggg 39896618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 164 - 204
Target Start/End: Original strand, 21670821 - 21670861
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||| |||||||||||||||||||||||||||    
T  21670821 tttttgcctggattgccctttcgggttttcgatccaccggg 21670861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 16278979 - 16278892
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||| ||||| |||||||||||||||||  |||| ||||| || ||||||| || ||  |||||||||||||||||||||    
T  16278979 ccctaatttttgtctggaccgccctttcgggttttcagtccatcgggacgctcatttttggcttaaaccgccctttcgggttttcgac 16278892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 241
Target Start/End: Complemental strand, 31882808 - 31882733
Alignment:
Q  166 tttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  31882808 tttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 31882733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 254369 - 254447
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  254369 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 254447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 12710318 - 12710396
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  12710318 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 12710396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 19450135 - 19450213
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| | ||| |||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  19450135 atttttgcctgaaccgctctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 19450213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 23117321 - 23117243
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  23117321 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 23117243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 25500161 - 25500111
Alignment:
Q  156 gtcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||| | ||||||||||| ||||||||||||||||| ||||||||||||    
T  25500161 gtccctaacttttgcctggaccgccctttcgggttttcaatccaccgggaa 25500111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 27428170 - 27428248
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  27428170 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 27428248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27810228 - 27810150
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  27810228 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 27810150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 28888779 - 28888701
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  28888779 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 28888701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 34161371 - 34161293
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  34161371 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 34161293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 34268643 - 34268721
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  34268643 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 34268721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 37945582 - 37945660
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  37945582 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 37945660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 39896593 - 39896515
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  39896593 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 39896515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 3761036 - 3761077
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  3761036 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 3761077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 3789036 - 3788995
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||| ||||||||||||||||||||||||| |||||||||    
T  3789036 attttttcctggatcgccctttcgggttttcggtccaccggg 3788995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 11628836 - 11628877
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||||||||||||| ||||||||    
T  11628836 atttttgcttggatcgccctttcgggttttcgacccaccggg 11628877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15947690 - 15947731
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  15947690 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 15947731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 21696837 - 21696878
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| ||||||||||||||||||||| |||||||||||    
T  21696837 atttttgcttggatcgccctttcgggtttttgatccaccggg 21696878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 42569166 - 42569207
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  42569166 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 42569207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 227
Target Start/End: Original strand, 20277448 - 20277512
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 227  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || |||||||||||| |||||    
T  20277448 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcatttttgcctaagccgc 20277512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 239
Target Start/End: Original strand, 21670886 - 21670962
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttt 239  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||    
T  21670886 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttt 21670962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 260
Target Start/End: Original strand, 21753149 - 21753233
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttctt 260  Q
    |||||||||||||||||   |||| | || || |||||||||||| ||||||| ||||||||||||||| ||||  |||||||||    
T  21753149 cgccctttcgggttttcagcccactgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttctt 21753233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 239
Target Start/End: Original strand, 37679608 - 37679684
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttt 239  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||    
T  37679608 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttt 37679684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 239
Target Start/End: Original strand, 37694873 - 37694949
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttt 239  Q
    ||||||||||| |  ||||||||||||  || ||||| ||||  || |||||||||||| |||||||||||||||||    
T  37694873 atttttgcctgaactgccctttcgggtcgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttt 37694949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 12386955 - 12386908
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  12386955 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 12386908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 12387018 - 12386971
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  12387018 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 12386971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 15947752 - 15947838
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || || ||||||| || | |||||||| |||||||||||    
T  15947752 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcattttttgcttaag-cgccctttagggttttcgac 15947838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 25500086 - 25499999
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| ||| |||||||||||||  |||| || || || ||||||| || || ||| ||||||||||||||||||    
T  25500086 ccctaatttttgcctggaccgctctttcgggttttcagtccaacgagacgctcatttttggcttaagccaccctttcgggttttcgac 25499999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 201
Target Start/End: Complemental strand, 42396933 - 42396890
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| |||||| |||||||||||||||||||||||||    
T  42396933 ccctaatttttacctggaccgccctttcgggttttcgatccacc 42396890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Original strand, 3760078 - 3760120
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  3760078 ccctaatttttacctggaccgccctttcgggttttcgatccac 3760120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 20844439 - 20844361
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||| |||||||| || |||||  |||  || |||||||||||| |||||||||||||||||||    
T  20844439 atttttgcctgaactgccccttcgggttgtcaatccagtggggtgctcatttttgcctaagccgccctttcgggttttc 20844361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 21696903 - 21696981
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || |||||  |||  || |||||||||||| | |||||||||||||||||    
T  21696903 atttttgcctgaactgccctttcgggttgtcaatccagtggggtgctcatttttgcctaagtcgccctttcgggttttc 21696981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 233
Target Start/End: Complemental strand, 24694182 - 24694112
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 233  Q
    |||||||||| || |||||||||||||||||  ||||||| || || |||||||| ||| |||||| ||||    
T  24694182 atttttgcctagaccgccctttcgggttttcagtccaccgagacgctcatttttgtctaagccgccttttc 24694112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 27396861 - 27396783
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||| ||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  27396861 atttttgcctgaactgcccttttgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 27396783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 16279043 - 16279002
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||| ||| ||||||||||||    
T  16279043 ttttgcctggaccgccctttcgggtcttcaatccaccgggaa 16279002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 20616287 - 20616246
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||| |||||||||||| ||||||||||||    
T  20616287 ttttgcctggaccgccgtttcgggttttcaatccaccgggaa 20616246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 24290647 - 24290606
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| | ||||||||||||||| ||||||||||||    
T  24290647 ttttgcctggacctccctttcgggttttcaatccaccgggaa 24290606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 233
Target Start/End: Complemental strand, 20615429 - 20615361
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 233  Q
    |||||| ||||||||||||||||||||||  |||| || || || | |||||||||| |||||| ||||    
T  20615429 ttttgcatggatcgccctttcgggttttcagtccatcgagacgctcttttttgcctaagccgccttttc 20615361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 260
Target Start/End: Original strand, 21758110 - 21758193
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcccttt-cgggttttcgacctaccacgctgttctt 260  Q
    |||||||||||||||||   |||||| || || |||||| ||||| |||||||||| |||||||||||| ||||  |||||||||    
T  21758110 cgccctttcgggttttcagcccaccgagacgctcatttt-gcctaagccgcccttttcgggttttcgacttaccgagctgttctt 21758193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 112)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 1906125 - 1905910
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  1906125 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 1906029  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||    
T  1906028 tttcaatccaccgggaagcgcatttttgcctaggccgccctttcgggtttttgacctaccacgctgttcttttcatatatctaggcaaagtatttcttga 1905929  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  1905928 ctatatcagcattcacagg 1905910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 30759636 - 30759422
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  30759636 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 30759538  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  30759537 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 30759438  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  30759437 ctatatcagcattcac 30759422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 33668194 - 33668408
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| ||||||||||||  |||||||||||||||||||| ||||||||         ||||||||||||||||||||| |||||||||||||    
T  33668194 gagacgctcatttttgcctgagttgtttacaatctcagcgagctttt-catatttgtttttttttggtcccttatttttgcctggaccgccctttcgggt 33668292  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  33668293 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 33668392  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  33668393 ctatatcagcattcac 33668408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 15277025 - 15277237
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||| |||||| |||||||||||||    
T  15277025 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgttttt-----gtcccttattttt-cctggaccgccctttcgggt 15277118  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||    
T  15277119 tttcgatccaccgggaagcgcatttttgccaaggccaccctttcgggttttcgaccttccacgctgttcttttcatatatctaggcaaagtatttcttga 15277218  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  15277219 ctatatcagcattcacagg 15277237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5700411 - 5700197
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  5700411 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttgttttttgtcccttatttttgcctggaccgccctttcgggt 5700313  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |||||||||||||    
T  5700312 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttttaggcaaagtatttcttga 5700213  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5700212 ctatatcggcattcac 5700197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 20332816 - 20333028
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  20332816 gagacgctcattcttgcctgatttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 20332912  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  20332913 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 20333012  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  20333013 ctatatcggcattcac 20333028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 40100030 - 40100244
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  40100030 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttcttttttgtcccttatttttgcctggaccgccctttcgggt 40100128  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| |    
T  40100129 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttgcatatttctaggcaaagtatttcttaa 40100228  T
Q  290 ctatatcagcattcac 305  Q
    ||||||||||||||||    
T  40100229 ctatatcagcattcac 40100244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 54839264 - 54839053
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  54839264 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttttcatatatatttttt----gtcccttatttttgcctggaccgccctttcgggt 54839169  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  54839168 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 54839069  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  54839068 ctatatcggcattcac 54839053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 6575734 - 6575520
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  6575734 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatattttttttttgtcccttatttttgcctggaccgccctttcgggt 6575636  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  6575635 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 6575536  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  6575535 ctatatcggcattcac 6575520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 14104416 - 14104205
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||          |||||||||||||||||||| |||||||||||||    
T  14104416 gagacgctcatttttgcctgagttgcgaacaatctcagcgagcttcttcatatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 14104321  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  14104320 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 14104221  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  14104220 ctatatcggcattcac 14104205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 18795010 - 18795221
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          ||||||| |||||||||||| |||||||||||||    
T  18795010 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgttttttt---gtcccttgtttttgcctggaccgccctttcgggt 18795105  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18795106 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18795205  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18795206 ctatatcggcattcac 18795221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 21975573 - 21975363
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||| ||||||| |||||||||||||    
T  21975573 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgttttttt---gtcccttatttt-gcctggaccgccctttcgggt 21975479  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  21975478 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 21975379  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  21975378 ctatatcggcattcac 21975363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 24586755 - 24586968
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| || |           |||||||||||||||||||| |||||||||||||    
T  24586755 gagacactcattcttgcctgagttgcgtacaatctcagcgagctttttcaaatatttttttttt--gtcccttatttttgcctggaccgccctttcgggt 24586852  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  24586853 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 24586952  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  24586953 ctatatcggcattcac 24586968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 36338911 - 36339124
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| || ||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  36338911 gagacgctcattcttgcctgagttgcgtgcactctcagcgagctttttcatatatatatttttt--gtcccttatttttgcctggaccgccctttcgggt 36339008  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  36339009 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 36339108  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  36339109 ctatatcggcattcac 36339124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 39856509 - 39856299
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  39856509 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 39856415  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  39856414 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 39856315  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  39856314 ctatatcggcattcac 39856299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 17018924 - 17018708
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatt-tgnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    |||||||||||||||||||||||||| | ||||||||||||||||||||||||| |           |||||||||||||||||||| ||||||||||||    
T  17018924 gagacgctcattcttgcctgagttgcatgcaatctcagcgagctttttcatattattatttttttttgtcccttatttttgcctggaccgccctttcggg 17018825  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||    
T  17018824 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttg 17018725  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  17018724 actatatcggcattcac 17018708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 14753886 - 14754099
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||| ||||||||||||||||||| || |||||||||||||||||| ||||||||         | ||||||||||||||||||| |||||||||||||    
T  14753886 gagacactcattcttgcctgagttgtgttcaatctcagcgagctttt-catatttgtttttttttg-tcccttatttttgcctggaccgccctttcgggt 14753983  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  14753984 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 14754083  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  14754084 ctatatcggcattcac 14754099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 18311572 - 18311785
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| |||||||||||||    
T  18311572 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttttttg-tcccttatttttgcctggaccgccctttcgggt 18311669  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  18311670 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 18311769  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  18311770 ctatatcggcattcac 18311785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 15233689 - 15233475
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||| |||||||||||||||||||||| ||| |||           |||||||||||| ||||||| |||||||||||||    
T  15233689 gagacgctcattcttgcctgagttacgtacaatctcagcgagctttt-cattttttttttttgt--gtcccttatttt-gcctggaccgccctttcgggt 15233594  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  15233593 tttcgatccgccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttga 15233494  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||||||||||||||    
T  15233493 ctatatcagcattcacagg 15233475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5011749 - 5011537
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  5011749 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 5011653  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||| |||||||||||||    
T  5011652 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttctcatttctaggcaaagtatttcttga 5011553  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5011552 ctatatcggcattcac 5011537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 14670888 - 14670675
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |          | ||||||||||||||||||| ||||||||| |||    
T  14670888 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatatatttttttttg-tcccttatttttgcctggaccgccctttcaggt 14670791  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  14670790 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 14670691  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  14670690 ctatatcggcattcac 14670675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 24118534 - 24118324
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |           |||||||||||||||||||| ||||||||||||    
T  24118534 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagcttttttcatatatttttt------gtcccttatttttgcctggaccgccctttcggg 24118441  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||    
T  24118440 ttttcgatccaccgggaagtgcatatttgcctaggccgccctttcgggttttcgacctatcacgctgttcttttcatatttctaggcaaagtatttcttg 24118341  T
Q  289 actatatcagcattcac 305  Q
    |||||||||||||||||    
T  24118340 actatatcagcattcac 24118324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 90 - 302
Target Start/End: Original strand, 31120907 - 31121116
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| ||||| |           |||||||||||||||||||| |||||||||||||    
T  31120907 gagacgctcattcttgcctgagttgtttacaatctcagcgagctttt-catatatatttttttt--gtcccttatttttgcctggaccgccctttcgggt 31121003  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  31121004 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 31121103  T
Q  290 ctatatcagcatt 302  Q
    ||||||| |||||    
T  31121104 ctatatcggcatt 31121116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 27157710 - 27157924
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttattttt-gcctggatcgcccttt-cgg 187  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |           ||||||||||||| ||||||| |||||||| |||    
T  27157710 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatatttttt----gtcccttattttttgcctggaccgcccttttcgg 27157805  T
Q  188 gttttcgatccaccgggaagcgcatttt-tgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttct 286  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||    
T  27157806 gttttcgatccaccgggaagcgcattttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttct 27157905  T
Q  287 tgactatatcagcattcac 305  Q
    |||||||||| ||||||||    
T  27157906 tgactatatcggcattcac 27157924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 34183355 - 34183565
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| |||||||||| ||||||||| ||||| |           ||||||||||||||| |||| |||||||||||||    
T  34183355 gagacgctcattcttgcctgagttgcatacaatctcaacgagctttt-catatatatttttt----gtcccttatttttgcatggaccgccctttcgggt 34183449  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  34183450 tttcgatccaccgggaagcgcatttttgcctaggccgccctctcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 34183549  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  34183550 ctatatcggcattcac 34183565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 90 - 308
Target Start/End: Original strand, 15380631 - 15380853
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnng----gtcccttatttttgcctggatcgcccttt 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||              |||||||||||| ||| ||||||||||||    
T  15380631 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttttcatatttgttttttttttttttgtcccttatttt-gccaggatcgcccttt 15380729  T
Q  185 cgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtattt 284  Q
    ||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||| | ||| ||||    
T  15380730 cgggttttcgacccaccgggaagcgcgtttttgccaaggccgccctttcgggttttcgaccttccacgctgttcttttcatacatctagacaaagaattt 15380829  T
Q  285 cttgactatatcagcattcacagg 308  Q
    |||||||||||| |||||||||||    
T  15380830 cttgactatatcggcattcacagg 15380853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 19770119 - 19769974
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  19770119 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 19770020  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  19770019 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 19769974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 14723288 - 14723433
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatt-tttgcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || |||| || |  || ||||||||||| |||||||||||||||  ||||||||||    
T  14723288 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcattcttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 14723387  T
Q  262 tcatatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    | |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  14723388 t-atatatttagacaaagtatttcttgactgcatcagaattcacagg 14723433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 33184121 - 33184035
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| || ||||||||||||||  |||||| ||| || |||||||||||| ||||||||||||||||||||||    
T  33184121 ccctaatttttgcctggaccgtcctttcgggttttcagtccaccaggacgctcatttttgcctaagccgccctttcgggttttcgac 33184035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 1878924 - 1879004
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc-atttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| ||||||||||||||||| ||||||||||| || |  |||||||||| ||||||||||||||||||||||    
T  1878924 ttttgcctggaccgccctttcgggttttcaatccaccgggatgctctttttttgcctaagccgccctttcgggttttcgac 1879004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 163 - 262
Target Start/End: Original strand, 1879594 - 1879694
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  1879594 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 1879693  T
Q  262 t 262  Q
    |    
T  1879694 t 1879694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 308
Target Start/End: Original strand, 22144057 - 22144203
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt-- 262  Q
    |||||| |||| |||| |||||||||||| ||||| || || || | ||||||  |||| |||||||||||||||||||||||||  ||| |||||||      
T  22144057 ttttgcatggaccgccttttcgggttttcaatccatcgagacgctcttttttgtttaggacgccctttcgggttttcgacctaccgagctattcttttac 22144156  T
Q  263 -catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
      |||||||||| | |||||||||||||||  ||||| |||||||||    
T  22144157 atatatatctagacaaagtatttcttgactgcatcagaattcacagg 22144203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 26215272 - 26215352
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| ||||||||||||||||||||||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  26215272 ttttgcctggaccgccctttcgggttttcgatccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 26215352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 55791643 - 55791726
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| ||||||||||||||||| ||||||||||| || |||||||||||| ||| || |||| |||||||    
T  55791643 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacgctcatttttgcctaagccaccttttcaggttttc 55791726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 260
Target Start/End: Complemental strand, 12517633 - 12517536
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 260  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || ||||||| |||| ||| |||||||||||||||||| ||||  |||||||||    
T  12517633 attttttcctggaccgccctttcgggttttcattccaccgagacgctcattttttcctaagccaccctttcgggttttcgacttaccgagctgttctt 12517536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 8097806 - 8097893
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  8097806 ccctaatttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 8097893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 20558859 - 20558776
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||| ||| || |||||||||||| |||||| |||| |||||||    
T  20558859 ccctaatttttgcctggaccgccctttcgggttttcagtccacctggacgctcatttttgcctaagccgccttttcaggttttc 20558776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 39857173 - 39857095
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||||  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  39857173 atttttgcctggactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 39857095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 3384854 - 3384935
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| ||||| |||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  3384854 atttttgcctggaccgcccattcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 3384935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 6576459 - 6576418
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  6576459 atttttgcctggatcgccctttcgggttttcgatccaccggg 6576418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 14105146 - 14105105
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14105146 atttttgcctggatcgccctttcgggttttcgatccaccggg 14105105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 14671617 - 14671576
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14671617 atttttgcctggatcgccctttcgggttttcgatccaccggg 14671576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 14753155 - 14753196
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14753155 atttttgcctggatcgccctttcgggttttcgatccaccggg 14753196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 14753221 - 14753302
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  14753221 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 14753302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 15234424 - 15234383
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15234424 atttttgcctggatcgccctttcgggttttcgatccaccggg 15234383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15276290 - 15276331
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15276290 atttttgcctggatcgccctttcgggttttcgatccaccggg 15276331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 15379899 - 15379940
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  15379899 atttttgcctggatcgccctttcgggttttcgatccaccggg 15379940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 17019653 - 17019612
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  17019653 atttttgcctggatcgccctttcgggttttcgatccaccggg 17019612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 18794281 - 18794322
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18794281 atttttgcctggatcgccctttcgggttttcgatccaccggg 18794322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 21976308 - 21976267
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  21976308 atttttgcctggatcgccctttcgggttttcgatccaccggg 21976267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 24119266 - 24119225
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24119266 atttttgcctggatcgccctttcgggttttcgatccaccggg 24119225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 30760366 - 30760325
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  30760366 atttttgcctggatcgccctttcgggttttcgatccaccggg 30760325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31120171 - 31120212
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  31120171 atttttgcctggatcgccctttcgggttttcgatccaccggg 31120212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 31120237 - 31120318
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||||||||||||||    
T  31120237 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttcgac 31120318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 33667464 - 33667505
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33667464 atttttgcctggatcgccctttcgggttttcgatccaccggg 33667505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 34182625 - 34182666
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  34182625 atttttgcctggatcgccctttcgggttttcgatccaccggg 34182666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 36323977 - 36324018
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  36323977 atttttgcctggatcgccctttcgggttttcgatccaccggg 36324018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 36338186 - 36338227
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  36338186 atttttgcctggatcgccctttcgggttttcgatccaccggg 36338227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 40099297 - 40099338
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40099297 atttttgcctggatcgccctttcgggttttcgatccaccggg 40099338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 54839995 - 54839954
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  54839995 atttttgcctggatcgccctttcgggttttcgatccaccggg 54839954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 1674465 - 1674422
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||||||||||||||| |||||||||||||||||||||||||    
T  1674465 atttttgcctggatcgccttttcgggttttcgatccaccgggaa 1674422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 1906864 - 1906821
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||||| |||||||||||||||||||||||||||||||||||    
T  1906864 atttttgcttggatcgccctttcgggttttcgatccaccgggaa 1906821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 158 - 228
Target Start/End: Original strand, 3830507 - 3830577
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||| | ||||||    
T  3830507 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcccaagccgcc 3830577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 5701078 - 5701000
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  5701078 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 5701000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 27157039 - 27157117
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  27157039 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 27157117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 30760300 - 30760222
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  30760300 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 30760222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 33667530 - 33667608
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  33667530 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 33667608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 3361469 - 3361388
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  |||| || || || |||||||||||| |||||| |||| ||||| ||||    
T  3361469 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgcctaagccgccttttcaggtttgcgac 3361388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5012482 - 5012441
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
T  5012482 atttttgcctggatcgccctttcgggttttcaatccaccggg 5012441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 5701144 - 5701103
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  5701144 atttttgcctggatcgccctttcgggttttcgacccaccggg 5701103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 15895497 - 15895578
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  15895497 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 15895578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 21976242 - 21976161
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||| |||||||||    
T  21976242 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgagttttcgac 21976161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 27156973 - 27157014
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||||| |||||||||    
T  27156973 atttttgcctggatcgccctttcgggttttcggtccaccggg 27157014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 39857239 - 39857198
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  39857239 atttttgcctggatcgccctttcgggttttcgacccaccggg 39857198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 55786914 - 55786813
Alignment:
Q  160 cttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttc 258  Q
    ||||||||||||||   |||||||||||||||||   |||||| || || ||||||| |||| ||||||| ||||||||||||||| ||||  |||||||    
T  55786914 cttatttttgcctgagccgccctttcgggttttcagcccaccgagacgctcattttttcctaagccgcccttttcgggttttcgacttaccgagctgttc 55786815  T
Q  259 tt 260  Q
    ||    
T  55786814 tt 55786813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 9189274 - 9189190
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 241  Q
    |||| |||||||| |||| ||||||||||||||||| ||||||||||| || || ||||| |||| |||||| |||| |||||||    
T  9189274 ccctaatttttgcttggaccgccctttcgggttttcaatccaccgggacgctcattttttacctaagccgccttttcaggttttc 9189190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 165 - 249
Target Start/End: Original strand, 15570124 - 15570208
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctacc 249  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| |||| ||||    
T  15570124 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgacttacc 15570208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 165 - 249
Target Start/End: Original strand, 15574252 - 15574336
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctacc 249  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| |||| ||||    
T  15574252 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgacttacc 15574336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 241
Target Start/End: Complemental strand, 17019572 - 17019509
Alignment:
Q  178 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  17019572 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 17019509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 158 - 201
Target Start/End: Complemental strand, 19770752 - 19770709
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccacc 201  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
T  19770752 ccctaatttttacctggatcgccctttcgggttttcgatccacc 19770709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 20558138 - 20558059
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  20558138 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 20558059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 238
Target Start/End: Original strand, 36324044 - 36324119
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 238  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||||| ||||||||||||||    
T  36324044 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggtcgccctttcgggtt 36324119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 238
Target Start/End: Original strand, 36338253 - 36338328
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 238  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||||| ||||||||||||||    
T  36338253 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaggtcgccctttcgggtt 36338328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 39531675 - 39531596
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  ||||||| || || ||||||||||||  ||||| |||| ||||| ||||    
T  39531675 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaaaccgccttttcaggtttgcgac 39531596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 244
Target Start/End: Complemental strand, 5012401 - 5012335
Alignment:
Q  178 gccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| ||||||||||||    
T  5012401 gccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttcgac 5012335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 6576393 - 6576315
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | ||||||| |||||||||    
T  6576393 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgcccttccgggttttc 6576315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 14105080 - 14105002
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  14105080 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 14105002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 14671551 - 14671473
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  14671551 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 14671473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 308
Target Start/End: Original strand, 17296937 - 17297035
Alignment:
Q  211 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |||||||||| | |||||||||||| |||||| ||||||  |||||||||||  |||| ||||| | ||||||| ||||||  |||||| |||||||||    
T  17296937 atttttgcctggaccgccctttcggattttcggcctaccgagctgttcttttatatatgtctagacaaagtattgcttgaccgtatcagaattcacagg 17297035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 24119200 - 24119122
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  24119200 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 24119122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 34182691 - 34182769
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  34182691 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 34182769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 40099363 - 40099441
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| |||||||||    
T  40099363 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttc 40099441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 3363629 - 3363588
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||||| |||||||||||||||||||| ||||||||||||    
T  3363629 ttttgcctagatcgccctttcgggttttcaatccaccgggaa 3363588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 8097745 - 8097786
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  8097745 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 8097786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 22709784 - 22709719
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||||||||| |||||||||| || || |||||||||| |||||| |||| |||||||    
T  22709784 cgccctttcgggttttcggtccaccgggacgctcattttttgcctaagccgccttttcaggttttc 22709719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 14722583 - 14722623
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||||||||||||| |||||||| |||||||||||||||||    
T  14722583 ttttgcctggatcgtcctttcggattttcgatccaccggga 14722623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 227
Target Start/End: Original strand, 16723181 - 16723245
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgc 227  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||    
T  16723181 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgc 16723245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 3363566 - 3363503
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 221  Q
    |||| ||||||||||||| |||||||  ||||||||  |||||||||| || ||||||||||||    
T  3363566 ccctaatttttgcctggaccgcccttctgggttttcagtccaccgggacgctcatttttgccta 3363503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 20332084 - 20332127
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| | |||||||||||||||| |||||||||||||    
T  20332084 atttttgcctgaaccgccctttcgggtttttgatccaccgggaa 20332127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 24586022 - 24586065
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| | ||||||||||| ||||||||||||||||||    
T  24586022 atttttgcctgaaccgccctttcggattttcgatccaccgggaa 24586065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 238
Target Start/End: Complemental strand, 54839929 - 54839854
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggtt 238  Q
    ||||||||||| |  |||||| |||||| || ||||| ||||  || |||||||||||| ||||||||||||||||    
T  54839929 atttttgcctgaactgcccttccgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggtt 54839854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 221
Target Start/End: Complemental strand, 3362166 - 3362108
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 221  Q
    ||||||||||||| |||||||||||||||||  |||| || || || ||||||||||||    
T  3362166 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgccta 3362108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 221
Target Start/End: Complemental strand, 3362863 - 3362805
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 221  Q
    ||||||||||||| |||||||||||||||||  |||| || || || ||||||||||||    
T  3362863 atttttgcctggaccgccctttcgggttttcagtccatcgagacgctcatttttgccta 3362805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Original strand, 14722650 - 14722692
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||||| ||||||||||||||||||||||    
T  14722650 ccctaatttttacctggatcaccctttcgggttttcgatccac 14722692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 221
Target Start/End: Complemental strand, 14875078 - 14875020
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgccta 221  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || ||||||||||||    
T  14875078 atttttccctggaccgccctttcgggttttcagtccaccgagacgctcatttttgccta 14875020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 15379965 - 15380043
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| | ||  || |||||||||||| | |||||||||||||||||    
T  15379965 atttttgcctgaactgccctttcgggttgtcaatccagcagggtgctcatttttgcctaagtcgccctttcgggttttc 15380043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 228
Target Start/End: Complemental strand, 14923230 - 14923165
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    |||||||||||||   |||||||||||||||  |||||| ||| || |||||||||||| ||||||    
T  14923230 atttttgcctggacttccctttcgggttttcagtccaccaggacgctcatttttgcctaagccgcc 14923165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 14923289 - 14923248
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  14923289 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 14923248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 15894723 - 15894764
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  15894723 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 15894764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 22709861 - 22709820
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  22709861 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 22709820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 33184183 - 33184142
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| | ||||||||||||||| ||||||||||||    
T  33184183 ttttgcctggaccaccctttcgggttttcaatccaccgggaa 33184142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 12616580 - 12616620
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  12616580 ttttgcctggaccgccctttcgggttttcagtccaccggga 12616620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 157; Significance: 2e-83; HSPs: 7)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 33158 - 32939
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtccctt-atttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |           ||||||| ||||||||||||| ||||||||||||    
T  33158 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatattatttttttttgtccctttatttttgcctggaccgccctttcggg 33059  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  33058 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 32959  T
Q  289 actatatcagcattcacagg 308  Q
    |||||||| |||||||||||    
T  32958 actatatcggcattcacagg 32939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 211 - 305
Target Start/End: Complemental strand, 9703 - 9609
Alignment:
Q  211 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||| | ||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| ||||||||    
T  9703 atttttgcctggaccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttgactatatcggcattcac 9609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 90 - 195
Target Start/End: Complemental strand, 9775 - 9671
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |           |||||||||||||||||||| |||||||||||||    
T  9775 gagacgctcattcttgcctgagttgtgtacaatctcagcgagc-ttttcatatattatttctttttgtcccttatttttgcctggaccgccctttcgggt 9677  T
Q  190 tttcga 195  Q
    ||||||    
T  9676 tttcga 9671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 33888 - 33847
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  33888 atttttgcctggatcgccctttcgggtttccgatccaccggg 33847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 164 - 204
Target Start/End: Complemental strand, 10506 - 10466
Alignment:
Q  164 tttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||| |||||||||||||||||||||||||    
T  10506 tttttgcctggatcgtcctttcgggttttcgatccaccggg 10466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 10441 - 10363
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  10441 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 10363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 33822 - 33744
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || | |||||||||| ||||||||| |||||||||    
T  33822 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcctttttgcctaagccgcccttccgggttttc 33744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0288 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: scaffold0288
Description:

Target: scaffold0288; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 238 - 28
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  238 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 144  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  143 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 44  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  43 ctatatcggcattcac 28  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 153; Significance: 4e-81; HSPs: 3)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 9321 - 9535
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  9321 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttgttttttgtcccttatttttgcctggaccgccctttcgggt 9419  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |||||||||||||    
T  9420 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttttaggcaaagtatttcttga 9519  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  9520 ctatatcggcattcac 9535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 8656 - 8734
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| || ||||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  8656 atttttgcctgaattgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 8734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 8590 - 8631
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  8590 atttttgcctggatcgccctttcgggttttcgacccaccggg 8631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 153; Significance: 4e-81; HSPs: 3)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 5927 - 5716
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |           |||||||||||||||||||| |||||||||||||    
T  5927 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttttcatatatttttttt----gtcccttatttttgcctggaccgccctttcgggt 5832  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  5831 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 5732  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  5731 ctatatcggcattcac 5716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 6656 - 6615
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  6656 atttttgcctagatcgccctttcgggttttcgatccaccggg 6615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 6590 - 6512
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  6590 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 6512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 153; Significance: 4e-81; HSPs: 3)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 13810 - 13598
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  13810 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 13714  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||    
T  13713 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttctaggcaaagtatttcttga 13614  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  13613 ctatatcggcattcac 13598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 14543 - 14502
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  14543 atttttgcctggatcgccctttcgggttttcgatccaccggg 14502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 14477 - 14399
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  14477 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 14399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 18446 - 18231
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatattt-gnnnnnnnnnggtcccttatttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |          |||||||||||||||||||| ||||||||||||    
T  18446 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catattttgttttttttttgtcccttatttttgcctggaccgccctttcggg 18348  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  18347 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 18248  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  18247 actatatcggcattcac 18231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0418 (Bit Score: 149; Significance: 1e-78; HSPs: 3)
Name: scaffold0418
Description:

Target: scaffold0418; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 11899 - 11685
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  11899 gagacgctcattcttgcctgagttgcatacaatctcagcgagctttt-catatttgttttttttttgtcccttatttttgcctggaccgccctttcgggt 11801  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  11800 tttcgatccaccgggaagcgcatttttgcctaagccgccctctcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 11701  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  11700 ctatatcggcattcac 11685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0418; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 12628 - 12587
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  12628 atttttgcctggatcgccctttcgggttttcgatccaccggg 12587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0418; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 12562 - 12484
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  12562 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 12484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 149; Significance: 1e-78; HSPs: 3)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 15430 - 15220
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  15430 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttt----gtcccttatttttgcctggaccgccctttcgggt 15336  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||    
T  15335 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttttaggcaaagtatttcttga 15236  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  15235 ctatatcggcattcac 15220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 16103 - 16025
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| |||||||||||||||||||    
T  16103 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgccctttcgggttttc 16025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 16169 - 16128
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  16169 atttttgcctggatcgccctttcgggttttcgacccaccggg 16128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322 (Bit Score: 149; Significance: 1e-78; HSPs: 6)
Name: scaffold0322
Description:

Target: scaffold0322; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 1518 - 1307
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||          |||||||||||||||||||| |||||||||||||    
T  1518 gagacgctcattcttgcctgagttgcgtgcaatctcagcgagctttt-catttttgttttttt---gtcccttatttttgcctggaccgccctttcgggt 1423  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  1422 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 1323  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  1322 ctatatcggcattcac 1307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 11908 - 11691
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||          |||||||||||| ||||||| |||||||||||||    
T  11908 gagacgctcattcttgtctgagttgtgtacaatctcagcgagctttttcatatttgttttttttttgtcccttatttt-gcctggaccgccctttcgggt 11810  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||    
T  11809 tttcgatccaccgagaagcgcatttttgcctaggccgccctttcgggttttcgacctagcacgctgttcttttcatatatataggcaaagtatttcttga 11710  T
Q  290 ctatatcagcattcacagg 308  Q
    |||||||  ||||||||||    
T  11709 ctatatcgacattcacagg 11691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 2184 - 2103
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||| ||||||| ||||||||| ||||||||||||    
T  2184 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcattcttgcctaagccgcccttccgggttttcgac 2103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 2250 - 2209
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||||||||||||||||||||||    
T  2250 atttttgcttggatcgccctttcgggttttcgatccaccggg 2209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 12571 - 12493
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |   |||||||||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  12571 atttttgcctgaactaccctttcgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 12493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0322; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 12637 - 12596
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||| |||||||||||||| || |||||||||||||||    
T  12637 atttttgcttggatcgccctttcaggctttcgatccaccggg 12596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 149; Significance: 1e-78; HSPs: 6)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 3574 - 3786
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||          |||||||||||||||||||| |||||||||||||    
T  3574 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttt-catatttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 3670  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  3671 tttcgatccaccgggaaacgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 3770  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  3771 ctatatcggcattcac 3786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 166 - 305
Target Start/End: Original strand, 13263 - 13402
Alignment:
Q  166 tttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcat 265  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13263 tttgcctggaccgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcat 13362  T
Q  266 atatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    || ||||||| |||||||||||||||||||| ||||||||    
T  13363 atttctaggcaaagtatttcttgactatatcggcattcac 13402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 2840 - 2881
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2840 atttttgcctggatcgccctttcgggttttcgatccaccggg 2881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 18401 - 18360
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  18401 atttttgcctggatcgccctttcgggttttcgatccaccggg 18360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 2906 - 2984
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  2906 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 2984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 18335 - 18257
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  |||||||||||||||| ||||| ||||  || |||||||||||| ||||||||||| |||||||    
T  18335 atttttgcctgaactgccctttcgggttttcaatccagcggggtgctcatttttgcctaagccgccctttcaggttttc 18257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0242 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: scaffold0242
Description:

Target: scaffold0242; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 91 - 308
Target Start/End: Complemental strand, 344 - 130
Alignment:
Q  91 agacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |           |||||||||||| ||||||| |||||||||||||    
T  344 agacgctcattcttgcctgagttgcgtacaatctcagcgagcttttttcatatattttttttt---gtcccttatttt-gcctggaccgccctttcgggt 249  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  248 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcaaagtatttcttga 149  T
Q  290 ctatatcagcattcacagg 308  Q
    ||||||||| |||||||||    
T  148 ctatatcagtattcacagg 130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 20586 - 20798
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||| ||||||| ||||||||||||||||||||||| ||| ||||          |||||||||||||||||||| |||||||||||||    
T  20586 gagacgctcattctttcctgagtcgcgtacaatctcagcgagctttt-catttttgtttttttt--gtcccttatttttgcctggaccgccctttcgggt 20682  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
T  20683 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttga 20782  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  20783 ctatatcggcattcac 20798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 242
Target Start/End: Complemental strand, 9174 - 9089
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcg 242  Q
    |||| ||||||||||||| | |||||||||||||| ||||||||  |  || || ||||||| || ||||||| ||||||||||||    
T  9174 ccctaatttttgcctggaccaccctttcgggtttttgatccaccaaggtgctcattttttgcttaagccgcccattcgggttttcg 9089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: scaffold0240
Description:

Target: scaffold0240; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 25295 - 25506
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||| |||||||||||||||||||| | ||||||||||||||||||||||||||          | ||||||||||||||||||| |||||||||||||    
T  25295 gagacactcattcttgcctgagttgcatgcaatctcagcgagctttttcatattt----ttttttgttcccttatttttgcctggaccgccctttcgggt 25390  T
Q  190 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttga 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||| ||||||||||| |    
T  25391 tttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacactgttcttttcacatttctaggcaaagtatttcttta 25490  T
Q  290 ctatatcagcattcac 305  Q
    ||||||| ||||||||    
T  25491 ctatatcggcattcac 25506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 24615 - 24656
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  24615 atttttgcctggatcgccctttcgggttttcgatccaccggg 24656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0792 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0792
Description:

Target: scaffold0792; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 90 - 305
Target Start/End: Original strand, 5001 - 5213
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtccctt-atttttgcctggatcgccctttcggg 188  Q
    ||||||||||||||||||||||||| |||||||||||||||||||| | |||||           | |||||| ||||||||||||| ||||||||||||    
T  5001 gagacgctcattcttgcctgagttgtgtacaatctcagcgagctttat-atatt---atttttttgttccctttatttttgcctggaccgccctttcggg 5096  T
Q  189 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttg 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  5097 ttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttg 5196  T
Q  289 actatatcagcattcac 305  Q
    |||||||| ||||||||    
T  5197 actatatcggcattcac 5213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0792; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 4262 - 4304
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttc-gatccaccggg 204  Q
    ||||||||||||||||||||||||||||||| |||||||||||    
T  4262 atttttgcctggatcgccctttcgggttttcggatccaccggg 4304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 90 - 305
Target Start/End: Complemental strand, 11891 - 11672
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnng---gtcccttattttt-gcctggatcgccctttc 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||   ||||||             ||||||||||||| ||||||| |||||||||    
T  11891 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttcattatttgttttgttttttttgtcccttattttttgcctggaccgccctttc 11792  T
Q  186 gggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttc 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |||||||||    
T  11791 gggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcacatttttaggcaaagtatttc 11692  T
Q  286 ttgactatatcagcattcac 305  Q
    ||||||||||| ||||||||    
T  11691 ttgactatatcggcattcac 11672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 90 - 308
Target Start/End: Complemental strand, 24977 - 24762
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttt-catatttgnnnnnnnnnggtcccttatttttgcctggatcgccc-tttcgg 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||          ||||||||||||| ||| |||||||| ||||||    
T  24977 gagacgctcattcttgcctgagttgcgtacaatctcagcgagcttttttcatatttgtttttt----gtcccttattttt-cctagatcgcccctttcgg 24883  T
Q  188 gttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttctt 287  Q
    |||||||||||||||||||||||||||| ||| ||||| | |||||||||||||||||| |||||||||||||||||||||||||| | ||| |||||||    
T  24882 gttttcgatccaccgggaagcgcattttggccaaggcctcactttcgggttttcgaccttccacgctgttcttttcatatatctagacaaagaatttctt 24783  T
Q  288 gactatatcagcattcacagg 308  Q
    ||||||||| |||||||||||    
T  24782 gactatatcggcattcacagg 24762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 25715 - 25674
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    |||||||||||||||||||||||||||||| |||||||||||    
T  25715 atttttgcctggatcgccctttcgggtttttgatccaccggg 25674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 25649 - 25571
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||| ||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  25649 atttttgcctgaactgcccttttgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 25571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547 (Bit Score: 75; Significance: 2e-34; HSPs: 4)
Name: scaffold0547
Description:

Target: scaffold0547; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 211 - 305
Target Start/End: Original strand, 10103 - 10197
Alignment:
Q  211 atttttgcctaggccgccctttcgggttttcgacctaccacgctgttcttttcatatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||    
T  10103 atttttgcctggaccgccctttcgggttttcgacctaccacgctgttcttttcatatttctaggcaaagtatttcttgactatatcggcattcac 10197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 10033 - 10135
Alignment:
Q  90 gagacgctcattcttgcctgagttgcgtacaatctcagcgagctttttcatatttgnnnnnnnnnggtcccttatttttgcctggatcgccctttcgggt 189  Q
    ||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |           |||||||||||||||||||| |||||||||||||    
T  10033 gagacgctcattcttgcctgagttgtgtacaatctcagcgagc-ttttcatatat--attttttttgtcccttatttttgcctggaccgccctttcgggt 10129  T
Q  190 tttcga 195  Q
    ||||||    
T  10130 tttcga 10135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 9303 - 9344
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  9303 atttttgcctggatcgccctttcgggttttcgatccaccggg 9344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0547; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Original strand, 9369 - 9447
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |  ||||||||||||| || ||||| ||||  || |||||||||||| ||||||||| |||||||||    
T  9369 atttttgcctgaactgccctttcgggttgtcaatccagcggggtgctcatttttgcctaagccgcccttccgggttttc 9447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0404 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: scaffold0404
Description:

Target: scaffold0404; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 165 - 308
Target Start/End: Complemental strand, 12983 - 12840
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttttc 263  Q
    ||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  |||||||||||     
T  12983 ttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttctttt- 12885  T
Q  264 atatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |||||| ||| | |||||||||||||||  ||||| |||||||||    
T  12884 atatatttagacaaagtatttcttgactgcatcagaattcacagg 12840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0404; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Complemental strand, 13625 - 13583
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  13625 ccctaatttttacctggaccgccctttcgggttttcgatccac 13583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0404; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Complemental strand, 13783 - 13741
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||| ||||||||||||||||||||||||    
T  13783 ccctaatttttacctggaccgccctttcgggttttcgatccac 13741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 15879 - 16028
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    |||||||| |||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  15879 atttttgcttggaccgccctttcgggttttctgtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 15978  T
Q  262 t---catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |    |||||||||| | |||||||||||||||  ||||| |||||||||    
T  15979 tatatatatatctagacaaagtatttcttgactgcatcagaattcacagg 16028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 15201 - 15277
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||   |||||| ||||||||||||||||  || || |||||||||||| || ||||||||||||||||    
T  15201 ttttgcctggacttcccttttgggttttcgatccaccatgatgctcatttttgcctaagctgccctttcgggttttc 15277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 228
Target Start/End: Original strand, 27715 - 27780
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    ||||||||||||| ||||||||| | |||||  ||||||| || || |||||||||||| ||||||    
T  27715 atttttgcctggaccgccctttcagtttttcagtccaccgagacgctcatttttgcctaagccgcc 27780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0046 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: scaffold0046
Description:

Target: scaffold0046; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 163 - 305
Target Start/End: Complemental strand, 51675 - 51527
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||||||||||| || || ||||||| |  || ||||||||||| |||||||||||||||  ||||||||||    
T  51675 atttttgcctggaccgccctttcgggttttcgatccaccgagacgctcatttttggtttaagccgccctttcaggttttcgacctaccgagctgttcttt 51576  T
Q  262 t-----catatatctaggcgaagtatttcttgactatatcagcattcac 305  Q
    |      |||||||||| | |||||||||||||||  ||||| ||||||    
T  51575 tatatatatatatctagacaaagtatttcttgactgcatcagaattcac 51527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0046; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 158 - 249
Target Start/End: Complemental strand, 52348 - 52254
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt---gcctaggccgccctttcgggttttcgacctacc 249  Q
    |||| |||||| |||||| ||||||||||||||||||||||||| ||  || | |||||   |  ||||||||||| ||||||||||||||||||    
T  52348 ccctaatttttacctggaccgccctttcgggttttcgatccaccagggcgctcttttttttggtttaggccgccctctcgggttttcgacctacc 52254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1837 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: scaffold1837
Description:

Target: scaffold1837; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 163 - 308
Target Start/End: Original strand, 1168 - 1315
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcct-aggccgccctttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||||  | |||||||||||||||||||||||||||||  ||||||||||    
T  1168 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttggtttaggccgccctttcgggttttcgacctaccgagctgttcttt 1267  T
Q  262 t-catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
    |  |  ||| ||| | |||||||||||||||  ||||| |||||||||    
T  1268 tgtaactatttagacaaagtatttcttgactgcatcagaattcacagg 1315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1837; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 527 - 607
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgc----atttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||||||||||| |||||||| |||||||||||  | |     |||||||||| |||||||||||||||||||    
T  527 ttttgcctggatcgcccttttgggttttcaatccaccgggatactctcttttttttgcctaagccgccctttcgggttttc 607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 52; Significance: 8e-21; HSPs: 4)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 163 - 261
Target Start/End: Complemental strand, 31939 - 31840
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttcttt 261  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| ||||||| ||||||||||||||| ||||  ||||||||||    
T  31939 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgcccttttcgggttttcgacttaccgagctgttcttt 31840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 89740 - 89661
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||| || | |||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  89740 ttttgcctagaccaccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 89661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 8034 - 8087
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt 216  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||    
T  8034 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcattttt 8087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 90455 - 90415
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  90455 ttttgcctggaccgccctttcgggttttcagtccaccggga 90415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 163 - 308
Target Start/End: Complemental strand, 33095 - 32952
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt 262  Q
    ||||||||||||| |||| ||||||||||||  ||||||| || || || ||||||||| | |||||||||||||||||||| ||||  | |||||||||    
T  33095 atttttgcctggaccgccatttcgggttttcagtccaccgagacgctcagttttgcctaagtcgccctttcgggttttcgacttaccgagttgttctttt 32996  T
Q  263 catatatctaggcgaagtatttcttgactatatcagcattcacagg 308  Q
     || | | ||| | |||||||||||||||| ||||| |||||||||    
T  32995 -at-tttttagacaaagtatttcttgactacatcagaattcacagg 32952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 233
Target Start/End: Complemental strand, 33770 - 33702
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttc 233  Q
    ||||| ||||||||||||||||||||||| ||||||   ||  | |||||||||||| |||||| ||||    
T  33770 ttttgtctggatcgccctttcgggttttcaatccactatgacactcatttttgcctaagccgccttttc 33702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0799 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0799
Description:

Target: scaffold0799; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 5226 - 5309
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| ||||||||||||||||| ||||||||||| || |||||||||||| ||| || |||| |||||||    
T  5226 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacgctcatttttgcctaagccaccttttcaggttttc 5309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0799; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 329 - 228
Alignment:
Q  160 cttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccc-tttcgggttttcgacctaccacgctgttc 258  Q
    ||||||||||||||   |||||||||||||||||   |||||| || || ||||||| |||| ||||||| ||||||||||||||| ||||  |||||||    
T  329 cttatttttgcctgagccgccctttcgggttttcagcccaccgagacgctcattttttcctaagccgcccttttcgggttttcgacttaccgagctgttc 230  T
Q  259 tt 260  Q
    ||    
T  229 tt 228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0257 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0257
Description:

Target: scaffold0257; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 237 - 150
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  237 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0257; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 206
Target Start/End: Complemental strand, 276 - 247
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||||||||||||||||||||||    
T  276 cgccctttcgggttttcgatccaccgggaa 247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 69111 - 69198
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  69111 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 69198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 69047 - 69088
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||||| || ||||||||||||||||| ||||||||||||    
T  69047 ttttgcctagaccgccctttcgggttttcaatccaccgggaa 69088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0306 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0306
Description:

Target: scaffold0306; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 19383 - 19302
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  19383 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 19302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0157 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0157
Description:

Target: scaffold0157; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 260
Target Start/End: Original strand, 3278 - 3375
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctt 260  Q
    |||||| |||||| |||||||||||||||||  ||||||| || || ||||||| |||| ||| |||||||||||||||||| ||||  |||||||||    
T  3278 attttttcctggaccgccctttcgggttttcattccaccgagacgctcattttttcctaagccaccctttcgggttttcgacttaccgagctgttctt 3375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 30027 - 30108
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||| ||||||  ||||||| || || |||||||||||| ||||||||||| ||||||||||    
T  30027 atttttgcctggaccgccctttcgagttttctgtccaccgagacgctcatttttgcctaagccgccctttcaggttttcgac 30108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 29251 - 29291
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||  ||||||||||    
T  29251 ttttgcctggaccgccctttcgggttttcagtccaccggga 29291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1418 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: scaffold1418
Description:

Target: scaffold1418; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 1400 - 1487
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| ||||||||||||||||| ||||| ||||| || ||||||| || || |||||||||||| |||||||||    
T  1400 ccctaatttttgcctggaccgccctttcgggttttcaatccatcgggacgctcatttttggcttaagccgccctttcgagttttcgac 1487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1418; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 158 - 242
Target Start/End: Original strand, 422 - 507
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcg 242  Q
    |||| ||||||||||||| | |||||||||||||| |||||| | ||  || ||||||| || || ||||||||||||||||||||    
T  422 ccctaatttttgcctggacctccctttcgggtttttgatccatcagggcgctcatttttggcttaagccgccctttcgggttttcg 507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1418; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 1336 - 1377
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||| ||||||||||||||||| ||||||||||||    
T  1336 ttttgtctggaccgccctttcgggttttcaatccaccgggaa 1377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0605 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: scaffold0605
Description:

Target: scaffold0605; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 3371 - 3458
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||  | ||||||| || || || |||||||||||||||||||    
T  3371 ccctaatttttgcctggaccgccctttcgggttttcaatccaccgggacactcatttttggcttaagctgccctttcgggttttcgac 3458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0605; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 3311 - 3352
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| ||||||||||||||||| ||||||||||||    
T  3311 ttttgcctggaccgccctttcgggttttcaatccaccgggaa 3352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0357 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: scaffold0357
Description:

Target: scaffold0357; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 10539 - 10460
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||||||||| ||||    
T  10539 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcgggtttgcgac 10460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0357; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 11243 - 11160
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  ||| |||||| || |||||||||||| |||||| |||| |||||||    
T  11243 ccctaatttttgcctggaccgccctttcgggttttcagtcccccgggacgctcatttttgcctaagccgccttttcaggttttc 11160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: scaffold0132
Description:

Target: scaffold0132; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 28414 - 28331
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || |||||||||||| | |||| |||| |||||||    
T  28414 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcatttttgcctaagtcgccttttcaggttttc 28331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 27697 - 27616
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  27697 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 27616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 32677 - 32596
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  32677 atttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 32596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 173226 - 173139
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| ||||||||||||||||   |||||||||| || || ||||||| || ||||||||||||||||||||||    
T  173226 ccctaatttttgcctggaccgccctttcgggtttttagtccaccgggacgctcattttttgcttaagccgccctttcgggttttcgac 173139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 249
Target Start/End: Complemental strand, 1689 - 1603
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctacc 249  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| |||| ||||    
T  1689 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgacttacc 1603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 2419 - 2333
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||| ||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| ||||||||||    
T  2419 ccctaattttagcctggaccgccctttcgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttcgac 2333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 181803 - 181886
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||| ||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  181803 ccctaatttttgcctggaccgcccttttgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttc 181886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 2478 - 2437
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  2478 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 2437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0582 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: scaffold0582
Description:

Target: scaffold0582; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 3601 - 3682
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  3601 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 3682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0582; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 2882 - 2965
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| | |||||  ||||||||  |||||||||| || |||||||||||| || ||| |||| |||||||    
T  2882 ccctaatttttgcctggaccacccttctgggttttcagtccaccgggacgctcatttttgcctaagctgccttttcaggttttc 2965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 3)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 154955 - 154914
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  154955 atttttgcctggatcgccctttcgggttttcgatccaccggg 154914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 15195 - 15279
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 241  Q
    |||| ||||||||||||| |||||||||||||||||  |||||||||| || || |||||||||| | |||| |||| |||||||    
T  15195 ccctaatttttgcctggaccgccctttcgggttttcagtccaccgggacgctcattttttgcctaagtcgccttttcaggttttc 15279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 15932 - 16013
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||| ||||||||  |||| || || || |||||||||||| |||||| |||| ||||| ||||    
T  15932 atttttgcctggaccgcccttttgggttttcagtccatcgagacgctcatttttgcctaagccgccttttcaggtttgcgac 16013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0094 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0094
Description:

Target: scaffold0094; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 260
Target Start/End: Original strand, 32738 - 32837
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc--ctttcgggttttcgacctaccacgctgttctt 260  Q
    ||||||||||||| |||||||||||||||||  ||||||| || || ||||||| |||| ||||||  |||| ||||||||||| ||||  |||||||||    
T  32738 atttttgcctggaccgccctttcgggttttcagtccaccgagacgctcattttttcctaagccgccctcttttgggttttcgacttaccgagctgttctt 32837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 21035 - 20955
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  21035 ttttgcctggaccgccctttcgggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 20955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0451 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0451
Description:

Target: scaffold0451; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 272 - 185
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||| ||||| || ||||||||||||||  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  272 ccctaatttttgtctggaccgtcctttcgggttttcagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0389 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0389
Description:

Target: scaffold0389; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 5288 - 5201
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| | ||||||||||||| |  |||||||||| || ||||||| || || ||||||||||||||||||||||    
T  5288 ccctaatttttgcctggaccaccctttcgggtttccagtccaccgggacgctcatttttggcttaagccgccctttcgggttttcgac 5201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 21180 - 21259
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  21180 ttttgcctggaccgccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 21259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 20394 - 20443
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| |||||||||||||||||  |||||||||||    
T  20394 tccctaatttttgcctggaccgccctttcgggttttcagtccaccgggaa 20443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 244
Target Start/End: Complemental strand, 21097 - 21010
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    |||| ||||||||||||| ||||||||| |||||||  |||||| ||| || ||||||| || || ||||||||||||||||||||||    
T  21097 ccctaatttttgcctggaccgccctttcaggttttcagtccaccaggacgctcatttttggcttaagccgccctttcgggttttcgac 21010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 21163 - 21114
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||| ||||||||||||| ||||||||||||||||| ||||| ||||||    
T  21163 tccctaatttttgcctggaccgccctttcgggttttcaatccatcgggaa 21114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0243 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0243
Description:

Target: scaffold0243; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 18646 - 18565
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  18646 atttttgcctggaccgcccttttgggttttcactccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 18565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0243; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 19361 - 19320
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    |||||| |||| |||||||||||||||||| |||||||||||    
T  19361 ttttgcttggaccgccctttcgggttttcggtccaccgggaa 19320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0093 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0093
Description:

Target: scaffold0093; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 367 - 326
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccggg 204  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
T  367 atttttgcctggatcaccctttcgggttttcgatccaccggg 326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0093; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 299 - 223
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||| |  |||||| |||||| || ||||| ||||  || |||||||||||| | |||||||||||||||||    
T  299 ttttgcctgaactgcccttccgggttgtcaatccagcggggtgctcatttttgcctaagtcgccctttcgggttttc 223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0320 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0320
Description:

Target: scaffold0320; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 244
Target Start/End: Original strand, 2660 - 2739
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| |||||||| ||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  2660 ttttgcctggaccgcccttttgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 2739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 291
Target Start/End: Complemental strand, 155101 - 154976
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgacctaccacgctgttctttt 262  Q
    ||||||||||||| ||||||||||||||||| ||||||   || || ||||||| |||| |||||| |||| ||||| |||| |||   |||||||||      
T  155101 atttttgcctggaccgccctttcgggttttcaatccactaagacgctcattttttcctaagccgccttttcaggtttgcgacttacggagctgttctt-- 155004  T
Q  263 catatatctaggcgaagtatttcttgact 291  Q
     |||| | ||| | |||||||||||||||    
T  155003 -atatttttagacaaagtatttcttgact 154976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0721 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: scaffold0721
Description:

Target: scaffold0721; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 5530 - 5595
Alignment:
Q  177 cgccctttcgggttttcgatccaccgggaagcgca-tttttgcctaggccgccctttcgggttttc 241  Q
    |||||||||||||||||| |||||||||| || || |||||||||| |||||| |||| |||||||    
T  5530 cgccctttcgggttttcggtccaccgggacgctcattttttgcctaagccgccttttcaggttttc 5595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0721; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 5453 - 5494
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaa 206  Q
    ||||||||||| |||||||||||||||||  |||||||||||    
T  5453 ttttgcctggaccgccctttcgggttttcagtccaccgggaa 5494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0441 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0441
Description:

Target: scaffold0441; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 8131 - 8050
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| ||||||||| |||||||  ||||||| || || ||||||| |||| |||||| |||| ||||| ||||    
T  8131 atttttgcctggaccgccctttcaggttttcagtccaccgagacgctcatttttccctaagccgccttttcaggtttgcgac 8050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0125 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: scaffold0125
Description:

Target: scaffold0125; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 13413 - 13332
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||||| ||||||||  |||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  13413 atttttgcctggaccgccctttttggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 13332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0125; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 14112 - 14065
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    |||| ||||||||||||| |||||||||||||||||  ||||||||||    
T  14112 ccctaatttttgcctggaccgccctttcgggttttcagtccaccggga 14065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1056 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1056
Description:

Target: scaffold1056; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 205
Target Start/End: Original strand, 1168 - 1208
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||||||||| |||||||||||||||||| ||||||||||    
T  1168 ttttgcctggaccgccctttcgggttttcggtccaccggga 1208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0932 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0932
Description:

Target: scaffold0932; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 3812 - 3736
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttc 241  Q
    ||||||||||| |||||||||||||||||  |||||||||| || |  | ||||||| |||||| |||| |||||||    
T  3812 ttttgcctggaccgccctttcgggttttcagtccaccgggacgctctctattgcctaagccgccttttcaggttttc 3736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1661 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1661
Description:

Target: scaffold1661; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 1250 - 1171
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||||| || | |||||||||||||||  ||||||| || || |||||||||||| |||||| |||| ||||| ||||    
T  1250 ttttgcctagaccaccctttcgggttttcagtccaccgagacgctcatttttgcctaagccgccttttcaggtttgcgac 1171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 200
Target Start/End: Complemental strand, 79728 - 79686
Alignment:
Q  158 cccttatttttgcctggatcgccctttcgggttttcgatccac 200  Q
    |||| |||||| |||||||| ||||||||||||||||||||||    
T  79728 ccctaatttttacctggatcaccctttcgggttttcgatccac 79686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 79799 - 79761
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgg 203  Q
    |||||||||||||| |||||||| |||||||||||||||    
T  79799 ttttgcctggatcgtcctttcggattttcgatccaccgg 79761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0183 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0183
Description:

Target: scaffold0183; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 228
Target Start/End: Complemental strand, 33469 - 33404
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgcc 228  Q
    ||||||||||||| ||||||||||||||||   ||||||| || || |||||||||| | ||||||    
T  33469 atttttgcctggaccgccctttcgggtttttagtccaccgagacgctcatttttgccgaagccgcc 33404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 244
Target Start/End: Original strand, 190609 - 190690
Alignment:
Q  163 atttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcatttttgcctaggccgccctttcgggttttcgac 244  Q
    |||||| ||||||||||||||| ||||||||  ||||||| |  || |||||||| ||| |||||| |||| ||||| ||||    
T  190609 attttttcctggatcgcccttttgggttttcagtccaccgagtcgctcatttttgtctaagccgccttttccggtttgcgac 190690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1691 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1691
Description:

Target: scaffold1691; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 1237 - 1157
Alignment:
Q  165 ttttgcctggatcgccctttcgggttttcgatccaccgggaagcgcattttt-gcctaggccgccctttcgggttttcgac 244  Q
    ||||||||||| ||||||||  |||||||  |||||| ||| || ||||||| || || ||||||||| ||||||||||||    
T  1237 ttttgcctggaccgcccttttaggttttcagtccaccaggatgctcatttttggcttaagccgcccttgcgggttttcgac 1157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0327 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0327
Description:

Target: scaffold0327; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 16451 - 16403
Alignment:
Q  157 tcccttatttttgcctggatcgccctttcgggttttcgatccaccggga 205  Q
    ||||| |||||||||||||  ||||||||||||||||  ||||||||||    
T  16451 tccctaatttttgcctggacagccctttcgggttttcagtccaccggga 16403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0099 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0099
Description:

Target: scaffold0099; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 304
Target Start/End: Original strand, 41173 - 41292
Alignment:
Q  196 tccaccgggaagcgc-attttt--gcctaggcc-gcccttt-cgggtttt-cgacctaccacgc-tgttc-ttttca-tatatctaggcgaag-tatttc 285  Q
    ||||||||||||||| ||||||  ||||||||| ||||||| |||||||| ||||||||||||| ||||| |||||| ||| ||||||| ||| ||||||    
T  41173 tccaccgggaagcgctattttttcgcctaggcccgcccttttcgggtttttcgacctaccacgcttgttctttttcattatttctaggcaaagttatttc 41272  T
Q  286 ttgactatat-cagcattca 304  Q
    |||||||||| |||||||||    
T  41273 ttgactatatccagcattca 41292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University