View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1649_low_13 (Length: 249)

Name: NF1649_low_13
Description: NF1649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1649_low_13
NF1649_low_13
[»] chr3 (1 HSPs)
chr3 (9-249)||(17401342-17401582)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 17401342 - 17401582
Alignment:
Q  9 gagatgaaccccatcttagtgaggatagcttctaaataagaccaactaacactgtcaaaagatttagagatgccgagctttagagaaatatcacttattt 108  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17401342 gagaagaaccccatcttagtgaggatagcttctaaataagaccaactaacactgtcaaaagatttagagatgccgagctttagagaaatatcacttattt 17401441  T
Q  109 tccccttgtgcgtgaaacacatatgatggagaattttgaaagtcgttaaagcattatcggtgatggaccgagaatggacaaacgctgcctgcttcggaga 208  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17401442 tccccttgtgcgtgcaacacatatgatggagaattttgaaagtcgttaaagcattatcggtgatggaccgagaatggacaaacgctgcctgcttcggaga 17401541  T
Q  209 tatccacttattcataagaggacgaaggcggttggcaaggt 249  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  17401542 tatccacttattcataagaggacgaaggcggttggcaaggt 17401582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University