View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16486_low_49 (Length: 224)

Name: NF16486_low_49
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16486_low_49
NF16486_low_49
[»] chr3 (1 HSPs)
chr3 (19-208)||(47367416-47367605)
[»] chr1 (1 HSPs)
chr1 (106-198)||(5375056-5375148)


Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 47367605 - 47367416
Alignment:
Q  19 tattggtggaggtttaacggactactacaaagacactgttgcaatgggaacttttgcagccatagaacatggaatactagtatccagttcagcaggaaac 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47367605 tattggtggaggtttaacggactactacaaagacactgttgcaatgggaacttttgcagccatagaacatggaatactagtatccagttcagcaggaaac 47367506  T
Q  119 ggtggacctagtaaagcaagtttggctaatgttgcaccatggataaccactgtcggtgccggaactatagaccgcgatttccctgcctat 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47367505 ggtggacctagtaaagcaagtttggctaatgttgcaccatggataaccactgtcggtgccggaactatagaccgcgatttccctgcctat 47367416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 106 - 198
Target Start/End: Original strand, 5375056 - 5375148
Alignment:
Q  106 ttcagcaggaaacggtggacctagtaaagcaagtttggctaatgttgcaccatggataaccactgtcggtgccggaactatagaccgcgattt 198  Q
    |||||||||||| |||||||| |||   | ||| ||| | ||||| |||||||||||||| ||||| ||||||||||| || |||||||||||    
T  5375056 ttcagcaggaaatggtggaccaagtgctgaaagcttgtcaaatgtagcaccatggataacaactgttggtgccggaacaattgaccgcgattt 5375148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University