View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16486_low_42 (Length: 247)

Name: NF16486_low_42
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16486_low_42
NF16486_low_42
[»] chr4 (1 HSPs)
chr4 (18-239)||(46463894-46464114)


Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 46464114 - 46463894
Alignment:
Q  18 cttcagaaagacaacttagcccttaagtcataaaaatgtcataaactaatttannnnnnnnacatacattgaattggaccgtgaaaaaattgcgagctcg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||| |||||||||||||||||||||||    
T  46464114 cttcagaaagacaacttagcccttaagtcataaaaatgtcataaactaatttactttttt-acatacattgaattgaaccgtgaaaaaattgcgagctcg 46464016  T
Q  118 agttttgagtggtctataaataaattggggtctttactagtttattttcagtttgagcaatatcattgttttgcttacattactacactttgtagcggga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||    
T  46464015 agttttgagtggtctataaataaattggggtctttactagtttattttcagtttgagcaatatcattgttttgcttacat---tacactttgtagcggga 46463919  T
Q  218 a---accactgagcctttgctactc 239  Q
    |   ||||||||||| |||||||||    
T  46463918 aaccaccactgagccattgctactc 46463894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University