View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16486_high_32 (Length: 256)

Name: NF16486_high_32
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16486_high_32
NF16486_high_32
[»] chr1 (1 HSPs)
chr1 (1-240)||(30311139-30311378)


Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 30311378 - 30311139
Alignment:
Q  1 ttttgcaattatggaaaatttcataacctatgcctcaatttgtcaaacaaaaaatctataaaaacaggttgcattttacgattttacaatttaagtattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  30311378 ttttgcaattatggaaaatttcataacctatgcctcaatttgttaaacaaaaaatccataaaaacaggttgcattttacgattttacaatttaagtattc 30311279  T
Q  101 atttttcagcgagtatcaactcatggtatggactatagtctatagaatcatggattacctcgttttgaccggggaatgcatctttgatggcttttctgac 200  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30311278 atttttcagcgagtatcaactcatggtatggactatagtctacagaatcatggattacctcgttttgaccggggaatgcatctttgatggcttttctgac 30311179  T
Q  201 ttcttcgacggaggaaaccgcaacacctctcggaacgtta 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  30311178 ttcttcgacggaggaaaccgcaacacctctcggaacgtta 30311139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University