View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16481_high_22 (Length: 208)

Name: NF16481_high_22
Description: NF16481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16481_high_22
NF16481_high_22
[»] chr2 (2 HSPs)
chr2 (13-92)||(37305895-37305974)
chr2 (123-189)||(37305800-37305864)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 13 - 92
Target Start/End: Complemental strand, 37305974 - 37305895
Alignment:
Q  13 attattctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatctgaaagccatttaaggatct 92  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37305974 attaatctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatctgaaagccatttaaggatct 37305895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 123 - 189
Target Start/End: Complemental strand, 37305864 - 37305800
Alignment:
Q  123 gattttctagttgaagcttttttgattgtgaaatatgcaagctggtttaatgattccagctagtaac 189  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||    
T  37305864 gattttctagttgaagcttttttgattg--aaatatgcaagctggtttaatgattccagctagtaac 37305800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University