View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16478_low_14 (Length: 263)

Name: NF16478_low_14
Description: NF16478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16478_low_14
NF16478_low_14
[»] chr6 (1 HSPs)
chr6 (10-147)||(864899-865036)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 10 - 147
Target Start/End: Original strand, 864899 - 865036
Alignment:
Q  10 aaaggcaaaggtgtcattgatggtcaaggatctgtttggtggaatgatagtgagaaactaccaaaaaccaaaccaacggtaagaataatcatttcattga 109  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |  |||||     
T  864899 aaaggcaaaggtgtcattgatggtcaaggctctgtttggtggaatgatagtgagaaactaccaaaaaccaaaccaacggtaagaatagtcctagcattgg 864998  T
Q  110 acttctttatcattaaaatatgatttaatttatatgca 147  Q
    | |||| | |||||||||||||||| | ||||||||||    
T  864999 atttctatgtcattaaaatatgattcattttatatgca 865036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University