View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16475_high_9 (Length: 237)

Name: NF16475_high_9
Description: NF16475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16475_high_9
NF16475_high_9
[»] chr8 (1 HSPs)
chr8 (1-221)||(29607942-29608145)
[»] chr5 (1 HSPs)
chr5 (69-113)||(28136270-28136314)


Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29608145 - 29607942
Alignment:
Q  1 cactacataacaaggattgaaccaaatcaaaacaactcatccttcatatttgttggtgtcagacacgtacacatgtcagccactggacacgtcttggatc 100  Q
    ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||                 |||||||||||||||| ||||    
T  29608145 cactacatatcaatgattgaaccaaatcaaaacaactcatccttcatatttgttggtgtcag-----------------ccactggacacgtcttcgatc 29608063  T
Q  101 agaagtgtcagtggtactggtactgaacatagaactattagattctagatttttatgctccctttaaattgcaattgcagctacacgattgtgggttgtg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29608062 agaagtgtcagtggtactggtactgaacatagaactattagattctagatttttatgctccctttaaattgcaattgcagctacacgattgtgggttgtg 29607963  T
Q  201 agcttaaaatcatgtcaatgg 221  Q
    |||||||||||||||||||||    
T  29607962 agcttaaaatcatgtcaatgg 29607942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 113
Target Start/End: Original strand, 28136270 - 28136314
Alignment:
Q  69 acacatgtcagccactggacacgtcttggatcagaagtgtcagtg 113  Q
    ||||||||||| |||  |||||||||| |||||||||||||||||    
T  28136270 acacatgtcagacaccagacacgtcttcgatcagaagtgtcagtg 28136314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University