View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16471_low_44 (Length: 223)

Name: NF16471_low_44
Description: NF16471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16471_low_44
NF16471_low_44
[»] chr1 (1 HSPs)
chr1 (23-207)||(32973955-32974139)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 23 - 207
Target Start/End: Complemental strand, 32974139 - 32973955
Alignment:
Q  23 atgccctttaggtagggagatgagttcttatgggttgttcctcttcgtctctaatttattcatttgttacattttttcatctcttatcttgcacaacttc 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  32974139 atgccctttaggtagggagatgagttcttatgggttgttcctcttcgtctctaatttattcattagttacattttttcatctcttatcttgcacaacttc 32974040  T
Q  123 ttcaaatttcattggttcgaaatctgcagaggcataacaatgtgatattatcaatttccattgttttcttcataaagatcttcat 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32974039 ttcaaatttcattggttcgaaatctgcagaggcataacaatgtgatattatcaatttccattgttttcttcataaagatcttcat 32973955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University