View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16467_high_7 (Length: 255)

Name: NF16467_high_7
Description: NF16467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16467_high_7
NF16467_high_7
[»] chr2 (2 HSPs)
chr2 (48-110)||(7951440-7951502)
chr2 (187-241)||(7951582-7951636)


Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 48 - 110
Target Start/End: Original strand, 7951440 - 7951502
Alignment:
Q  48 caatgcgccaaatttgatttcttttgcgagattggtttcgggtccttttcttggatggtaagt 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7951440 caatgcgccaaatttgatttcttttgcgagattggtttcgggtccttttcttggatggtaagt 7951502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 7951582 - 7951636
Alignment:
Q  187 aggatgattgtgaatgatatgtatacttcagctatggtggggttggctatctctg 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7951582 aggatgattgtgaatgatatgtatacttcagctatggtggggttggctatctctg 7951636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University