View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16453_low_26 (Length: 242)

Name: NF16453_low_26
Description: NF16453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16453_low_26
NF16453_low_26
[»] chr1 (1 HSPs)
chr1 (1-132)||(28927507-28927635)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 28927507 - 28927635
Alignment:
Q  1 attaaggtgagaacctaatcaatgaagggtgagaggatcagtttaatgcacaccatatactacctttgatgaaatttcgggaaacaaaaaggaaaaagat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||  |||||||||||||||||||||||||||||    
T  28927507 attaaggtgagaacctaatcaatgaagggtgagaggatcagtttaatgcacaccatatac---ctttgacaaaatttcgggaaacaaaaaggaaaaagat 28927603  T
Q  101 ctttcatcatttcagcaacaaatagtagagaa 132  Q
    ||||||||||||||||||||||||||||||||    
T  28927604 ctttcatcatttcagcaacaaatagtagagaa 28927635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University