View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16451_low_19 (Length: 205)

Name: NF16451_low_19
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16451_low_19
NF16451_low_19
[»] chr4 (1 HSPs)
chr4 (15-187)||(3191626-3191798)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 187
Target Start/End: Original strand, 3191626 - 3191798
Alignment:
Q  15 cataggtgattgaaaaagactcaagagaatacaaatattttattattcatagtttgaaaatgactcaacatgcggaaatatgatgtgaacctgctctctt 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  3191626 cataggtgattgaaaaagactcaagagaatacaaatattttattattcatagtttgaaaatgactcaacatgaggaaatatgatgtgaacctgctctctt 3191725  T
Q  115 acaaacagaacattacatgaaagatgtcttgtatcttattgagtaatttggaaggatggtgggtagtaatagg 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3191726 acaaacagaacattacatgaaagatgtcttgtatcttattgagtaatttggaaggatggtgggtagtaatagg 3191798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University