View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16451_low_10 (Length: 353)

Name: NF16451_low_10
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16451_low_10
NF16451_low_10
[»] chr7 (2 HSPs)
chr7 (37-231)||(25152703-25152893)
chr7 (286-334)||(25152639-25152687)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 8e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 37 - 231
Target Start/End: Complemental strand, 25152893 - 25152703
Alignment:
Q  37 ggttggtcttttagagaacagagaaatttcctatcaatacctttgtaagaattggtttgattaatagaaggannnnnnnatcttacttgagcctatttta 136  Q
    |||||||||||  ||||||||||| ||||||||||||| | ||||||||||||||||||||||||| ||||        ||||||||||||| |||||||    
T  25152893 ggttggtctttctgagaacagagatatttcctatcaattc-tttgtaagaattggtttgattaatataaggtttgatttatcttacttgagc-tatttta 25152796  T
Q  137 tatgcatgcatatatgaatttataaacatattagtgttagggcatattaaatttcaac-aattgaattactataaatgtagtggttaataattgaa 231  Q
    |||||||| ||||||||||||||||||||   ||||||||||||| |||||||||||| || |||||||||||||||   ||||||||||||||||    
T  25152795 tatgcatgtatatatgaatttataaacattaaagtgttagggcatgttaaatttcaacaaaatgaattactataaat---gtggttaataattgaa 25152703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 286 - 334
Target Start/End: Complemental strand, 25152687 - 25152639
Alignment:
Q  286 aaccaacaaataattgagatacttaatatctatgtttgcagaaaccaat 334  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||    
T  25152687 aaccaacaaataattgagatacttaatatctatgtttgcataaaccaat 25152639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University