View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16451_high_10 (Length: 273)

Name: NF16451_high_10
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16451_high_10
NF16451_high_10
[»] chr8 (2 HSPs)
chr8 (15-127)||(13213442-13213553)
chr8 (198-252)||(13213622-13213676)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 13213442 - 13213553
Alignment:
Q  15 aaaacccaccacaaatttcaagcaccatgttgattggtatatgaaactagctagctaagctacttttatttttatggaagtaaagtaaagagatggtagt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  13213442 aaaacccaccacaaatttcaagcaccatgttgattggtatatgaaactagctagctaagctactttt-tttttatggaagtaaagtaaagagatggtagt 13213540  T
Q  115 tcaaggtttggag 127  Q
    |||||||||||||    
T  13213541 tcaaggtttggag 13213553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 198 - 252
Target Start/End: Original strand, 13213622 - 13213676
Alignment:
Q  198 caacttaggaagcttttgtttatgcggtttaataataatgagattgaggatgctg 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13213622 caacttaggaagcttttgtttatgcggtttaataataatgagattgaggatgctg 13213676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University