View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1643_low_142 (Length: 237)

Name: NF1643_low_142
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1643_low_142
NF1643_low_142
[»] chr8 (3 HSPs)
chr8 (14-126)||(36845957-36846069)
chr8 (123-222)||(36846101-36846200)
chr8 (14-73)||(36847825-36847884)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 14 - 126
Target Start/End: Original strand, 36845957 - 36846069
Alignment:
Q  14 agcacagaccgaagaatgacggagtttattgtcccacatcgataactaatggtagaatagagaggagccttggttatatagttaaaggccgtggagagat 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  36845957 agcaaagaccgaagaatgacggagtttattgtcccacatcgataactaatggtagaatagagaggagccttgattatatagttaaaggccgtggagagat 36846056  T
Q  114 ttaaagaacagtt 126  Q
    |||||||||||||    
T  36846057 ttaaagaacagtt 36846069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 123 - 222
Target Start/End: Original strand, 36846101 - 36846200
Alignment:
Q  123 agttttatacggtttttcattctagctagttgagtgagatggttggtatggttctattaccttattgacttgatttaattagctcagtagtgaagaactt 222  Q
    ||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36846101 agttttaaacggttttttattctagctagttgagtgagatggttggtatggttctattaccttattgacttgatttaattagctcagtagtgaagaactt 36846200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 73
Target Start/End: Original strand, 36847825 - 36847884
Alignment:
Q  14 agcacagaccgaagaatgacggagtttattgtcccacatcgataactaatggtagaatag 73  Q
    |||||| ||||||||||||| |||||||||||||||||||||||||||| | ||||||||    
T  36847825 agcacataccgaagaatgactgagtttattgtcccacatcgataactaacgctagaatag 36847884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University