View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1643_high_152 (Length: 209)

Name: NF1643_high_152
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1643_high_152
NF1643_high_152
[»] chr2 (1 HSPs)
chr2 (1-196)||(8825901-8826096)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 8825901 - 8826096
Alignment:
Q  1 tttacaatcactatcatcgatattgttagaccgattatctttcgaggtttgaatccaagatgttttgttttgtgtgtgagtgaatttataatggtgtttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  8825901 tttacaatcactatcatcgatattgttagaccgattatctttccaggtttgaatccaagatgtttggttttgtgtgtgagtgaatttataatggtgtttg 8826000  T
Q  101 tcacttcatctgccaacaaaataaaagaattgggtgcatccaatcaagatcataattgggaaaatcatgatagggattctatcttattcatgatct 196  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  8826001 tcacttcatctaccaacaaaataaaagaattgggtgcatccaatcaagatcataattgggaaaatcgtgatagggattctatcttattcatgatct 8826096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University