View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16439_low_3 (Length: 304)

Name: NF16439_low_3
Description: NF16439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16439_low_3
NF16439_low_3
[»] chr8 (2 HSPs)
chr8 (14-159)||(10245191-10245336)
chr8 (232-285)||(10245066-10245119)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 14 - 159
Target Start/End: Complemental strand, 10245336 - 10245191
Alignment:
Q  14 ttatacttccttcctttgacttattttttctatttgccttttaatcttcataaaagtttaatactcactcaatattttacattttttattggttctggaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10245336 ttatacttccttcctttgacttattttttctatttgccttttaatcttcataaaagtttaatactcactcaatattttacattttttattggttctggaa 10245237  T
Q  114 ttttctcttgctagtaattttttccttctagatgaacttgatttga 159  Q
    ||||||||||||||||||||||| |||||| |||||||||||||||    
T  10245236 ttttctcttgctagtaatttttttcttctacatgaacttgatttga 10245191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 232 - 285
Target Start/End: Complemental strand, 10245119 - 10245066
Alignment:
Q  232 tttcttctccactagccaactctgttgttttctatcactgtctaatgtttttct 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10245119 tttcttctccactagccaactctgttgttttctatcactgtctaatgtttttct 10245066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University