View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16438_low_47 (Length: 201)

Name: NF16438_low_47
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16438_low_47
NF16438_low_47
[»] chr4 (1 HSPs)
chr4 (15-183)||(9032457-9032625)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 9032625 - 9032457
Alignment:
Q  15 aaaatggtacttaggttaaattttgtcttttcacaatatcacgtggcacatgaaatcaattgttgtgattcacatatactccacatcactgtcatgtttt 114  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9032625 aaaatggtacttaggttaaattttgtctttacacaatatcacgtggcacatgaaatcaattgttgtgattcacatatactccacatcactgtcatgtttt 9032526  T
Q  115 cagaaatgaaaattgagtgttataattttgctcgattgttatgataaaatgattacatactagtcctat 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  9032525 cagaaatgaaaattgagtgttataattttgctcgattgttatgataaaatgattacatacgagtcctat 9032457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University