View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16438_low_41 (Length: 238)

Name: NF16438_low_41
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16438_low_41
NF16438_low_41
[»] chr7 (1 HSPs)
chr7 (1-120)||(2731166-2731285)


Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 2731285 - 2731166
Alignment:
Q  1 aaaggcgagaaatgcacacccgacaaggaggaaagggtatgtgcataatcttgatcaggttaccatccccttcttcttcagtaacttctaggatgaggta 100  Q
    |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||| || |||||||||    
T  2731285 aaaggcgagaaatgcacacccgacaaggaggaaaggttatgtgaataatcttgatcaggttaccatccccttcttcttcactaacttttaagatgaggta 2731186  T
Q  101 aaaatgataagagttatgga 120  Q
    ||||||||||||||||||||    
T  2731185 aaaatgataagagttatgga 2731166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University