View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16438_high_19 (Length: 343)

Name: NF16438_high_19
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16438_high_19
NF16438_high_19
[»] chr4 (1 HSPs)
chr4 (18-319)||(34962305-34962606)


Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 34962606 - 34962305
Alignment:
Q  18 atcatcggcagcagcgaggcaaggacggaggagtacaccacttttcttaagagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttc 117  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34962606 atcatcggcagcggcgaggcaaggacggaggagtacaccacttttcttaagagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttc 34962507  T
Q  118 ccgccatcagagactgatccgatcgatttcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagacgagggagggaggaga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34962506 ccgccatcagagactgatccgatcgatttcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagacgagggagggaggaga 34962407  T
Q  218 gtgtggtggcgcgtgacaacactcgtgactccattgggatcaaaatgtgggaagatgataaacaagtagagagtgatatatggatgatgttggtgttggt 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34962406 gtgtggtggcgcgtgacaacactcgtgactccattgggatcaaaatgtgggaagatgataaacaagtagagagtgatatatggatgatgttggtgttggt 34962307  T
Q  318 ac 319  Q
    ||    
T  34962306 ac 34962305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University