View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16437_low_13 (Length: 223)

Name: NF16437_low_13
Description: NF16437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16437_low_13
NF16437_low_13
[»] chr3 (1 HSPs)
chr3 (17-195)||(46467272-46467450)


Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 46467272 - 46467450
Alignment:
Q  17 aatatcggtgttccctaattgtgctaaaaaacaaattggagtataggaatatgttttataacatatggtgattgactgtgaaatagtttggtgctgattg 116  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46467272 aatattggtgttccctaattgtgctaaaaaacaaattggagtataggaatatgttttataacatatggtgattgactgtgaaatagtttggtgctgattg 46467371  T
Q  117 tactaaggagctgaatatggttggtggaatgaatctgatcatgtactggtgcgtgggacaagcgacatatggtctccat 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46467372 tactaaggagctgaatatggttggtggaatgaatctgatcatgtactggtgcgtgggacaagcgacatatggtctccat 46467450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University